EMAIL THIS PAGE TO A FRIEND

HIST1H2AH

histone cluster 1, H2ah

25 Gene Product Result for
Synonyms: H2A/S H2AFALii H2AH dJ86C11.1
UniProtKB ID: Q96KK5
Gene ID:
Human(85235) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a member of the histone H2A family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the histone microcluster on chromosome 6p21.33. [provided by RefSeq, Jul 2008]
Mouse(319168) histone cluster 1, H2ah
Rat(502125) histone cluster 1, H2ah
chicken(418708) histone cluster 1, H2ah
cow(616634) histone cluster 1, H2ah
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080596 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080596 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080596 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175659 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175659 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175659 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080596 Rosetta Predictions human pricing
XM_001071473 Rosetta Predictions rat pricing
XM_577573 Rosetta Predictions rat pricing
NM_175659 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080596 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047335 predicted 368
2 SASI_Hs01_00047336 predicted 375
3 SASI_Hs01_00047337 predicted 363
4 SASI_Hs01_00047338 predicted 104
5 SASI_Hs01_00047339 predicted 5
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071473 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00335270 predicted 104
2 SASI_Rn02_00335271 predicted 268
3 SASI_Rn02_00335272 predicted 20
4 SASI_Rn02_00335273 predicted 87
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_577573 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00406746 predicted 105
2 SASI_Rn02_00406747 predicted 271
3 SASI_Rn02_00406748 predicted 15
4 SASI_Rn02_00406749 predicted 95
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175659 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00142367 predicted 10
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080596
HIST1H2AH MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H2ah
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080596.1-106s1c1
Sequence:CCGGCGCAAGGGTAATTATGCCGAGCTCGAGCTCGGCATAATTACCCTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080596.1-288s1c1
Sequence:CCGGGCTGCTGGGCAAAGTCACCATCTCGAGATGGTGACTTTGCCCAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080596.1-216s1c1
Sequence:CCGGCGACAACAAGAAGACCCGTATCTCGAGATACGGGTCTTCTTGTTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080596.1-219s1c1
Sequence:CCGGCAACAAGAAGACCCGTATCATCTCGAGATGATACGGGTCTTCTTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080596.1-100s1c1
Sequence:CCGGCTGCTCCGCAAGGGTAATTATCTCGAGATAATTACCCTTGCGGAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080596.1-316s21c1
Sequence:CCGGGGTGGTGTCTTGCCCAATATCCTCGAGGATATTGGGCAAGACACCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080596.1-168s21c1
Sequence:CCGGGGAGTACCTGACCGCTGAGATCTCGAGATCTCAGCGGTCAGGTACTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080596.1-359s21c1
Sequence:CCGGAGACTGAGAGCCACCATAAGGCTCGAGCCTTATGGTGGCTCTCAGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080596
HIST1H2AH MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H2ah
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080596.1-106s1c1
Sequence:CCGGCGCAAGGGTAATTATGCCGAGCTCGAGCTCGGCATAATTACCCTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080596.1-288s1c1
Sequence:CCGGGCTGCTGGGCAAAGTCACCATCTCGAGATGGTGACTTTGCCCAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080596.1-216s1c1
Sequence:CCGGCGACAACAAGAAGACCCGTATCTCGAGATACGGGTCTTCTTGTTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080596.1-219s1c1
Sequence:CCGGCAACAAGAAGACCCGTATCATCTCGAGATGATACGGGTCTTCTTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080596.1-100s1c1
Sequence:CCGGCTGCTCCGCAAGGGTAATTATCTCGAGATAATTACCCTTGCGGAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080596.1-316s21c1
Sequence:CCGGGGTGGTGTCTTGCCCAATATCCTCGAGGATATTGGGCAAGACACCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080596.1-168s21c1
Sequence:CCGGGGAGTACCTGACCGCTGAGATCTCGAGATCTCAGCGGTCAGGTACTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080596.1-359s21c1
Sequence:CCGGAGACTGAGAGCCACCATAAGGCTCGAGCCTTATGGTGGCTCTCAGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080596
HIST1H2AH MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H2ah
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080596.1-106s1c1
Sequence:CCGGCGCAAGGGTAATTATGCCGAGCTCGAGCTCGGCATAATTACCCTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080596.1-288s1c1
Sequence:CCGGGCTGCTGGGCAAAGTCACCATCTCGAGATGGTGACTTTGCCCAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080596.1-216s1c1
Sequence:CCGGCGACAACAAGAAGACCCGTATCTCGAGATACGGGTCTTCTTGTTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080596.1-219s1c1
Sequence:CCGGCAACAAGAAGACCCGTATCATCTCGAGATGATACGGGTCTTCTTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080596.1-100s1c1
Sequence:CCGGCTGCTCCGCAAGGGTAATTATCTCGAGATAATTACCCTTGCGGAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080596.1-316s21c1
Sequence:CCGGGGTGGTGTCTTGCCCAATATCCTCGAGGATATTGGGCAAGACACCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080596.1-168s21c1
Sequence:CCGGGGAGTACCTGACCGCTGAGATCTCGAGATCTCAGCGGTCAGGTACTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080596.1-359s21c1
Sequence:CCGGAGACTGAGAGCCACCATAAGGCTCGAGCCTTATGGTGGCTCTCAGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175659
HIST1H2AH MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H2ah
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175659.1-27s21c1
Sequence:CCGGCAAGGCTCGCGCCAAGGCCAACTCGAGTTGGCCTTGGCGCGAGCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175659.1-104s21c1
Sequence:CCGGTCCGCAAGGGCAACTACTCGGCTCGAGCCGAGTAGTTGCCCTTGCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175659.1-212s21c1
Sequence:CCGGCCCGCGACAACAAGAAGACGCCTCGAGGCGTCTTCTTGTTGTCGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175659.1-160s21c1
Sequence:CCGGGCCGTGCTGGAGTACCTGACGCTCGAGCGTCAGGTACTCCAGCACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175659.1-174s21c1
Sequence:CCGGCCTGACGGCCGAGATCCTGGACTCGAGTCCAGGATCTCGGCCGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175659
HIST1H2AH MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H2ah
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175659.1-27s21c1
Sequence:CCGGCAAGGCTCGCGCCAAGGCCAACTCGAGTTGGCCTTGGCGCGAGCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175659.1-104s21c1
Sequence:CCGGTCCGCAAGGGCAACTACTCGGCTCGAGCCGAGTAGTTGCCCTTGCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175659.1-212s21c1
Sequence:CCGGCCCGCGACAACAAGAAGACGCCTCGAGGCGTCTTCTTGTTGTCGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175659.1-160s21c1
Sequence:CCGGGCCGTGCTGGAGTACCTGACGCTCGAGCGTCAGGTACTCCAGCACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175659.1-174s21c1
Sequence:CCGGCCTGACGGCCGAGATCCTGGACTCGAGTCCAGGATCTCGGCCGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175659
HIST1H2AH MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H2ah
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175659.1-27s21c1
Sequence:CCGGCAAGGCTCGCGCCAAGGCCAACTCGAGTTGGCCTTGGCGCGAGCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175659.1-104s21c1
Sequence:CCGGTCCGCAAGGGCAACTACTCGGCTCGAGCCGAGTAGTTGCCCTTGCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175659.1-212s21c1
Sequence:CCGGCCCGCGACAACAAGAAGACGCCTCGAGGCGTCTTCTTGTTGTCGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175659.1-160s21c1
Sequence:CCGGGCCGTGCTGGAGTACCTGACGCTCGAGCGTCAGGTACTCCAGCACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175659.1-174s21c1
Sequence:CCGGCCTGACGGCCGAGATCCTGGACTCGAGTCCAGGATCTCGGCCGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)