EMAIL THIS PAGE TO A FRIEND

HIST1H2AJ

histone cluster 1, H2aj

5 Gene Product Result for
Synonyms: H2A/E H2AFE dJ160A22.4
UniProtKB ID: Q99878, A2RUU6, Q5JXQ5
Gene ID:
Human(8331) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a member of the histone H2A family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the small histone gene cluster on chromosome 6p22-p21.3. [provided by RefSeq, Jul 2008]
Mouse(319174) histone cluster 1, H2aj
cow(783767) histone cluster 1, H2aj
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021066 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021066 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021066 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021066 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021066 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123038 predicted 362
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021066
VALIDATED
HIST1H2AJ MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H2aj
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021066.2-280s1c1
Sequence:CCGGCTCAACAAGCTTCTGGGCAAACTCGAGTTTGCCCAGAAGCTTGTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_021066.2-38s1c1
Sequence:CCGGCCAAGGCCAAGACCCGCTCTTCTCGAGAAGAGCGGGTCTTGGCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021066.2-219s1c1
Sequence:CCGGCAACAAGAAGACTCGCATCATCTCGAGATGATGCGAGTCTTCTTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021066.2-100s1c1
Sequence:CCGGCTGCTCCGCAAAGGCAACTATCTCGAGATAGTTGCCTTTGCGGAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_021066.2-264s1c1
Sequence:CCGGCCGCAACGATGAGGAGCTCAACTCGAGTTGAGCTCCTCATCGTTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021066
VALIDATED
HIST1H2AJ MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H2aj
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021066.2-280s1c1
Sequence:CCGGCTCAACAAGCTTCTGGGCAAACTCGAGTTTGCCCAGAAGCTTGTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_021066.2-38s1c1
Sequence:CCGGCCAAGGCCAAGACCCGCTCTTCTCGAGAAGAGCGGGTCTTGGCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021066.2-219s1c1
Sequence:CCGGCAACAAGAAGACTCGCATCATCTCGAGATGATGCGAGTCTTCTTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021066.2-100s1c1
Sequence:CCGGCTGCTCCGCAAAGGCAACTATCTCGAGATAGTTGCCTTTGCGGAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_021066.2-264s1c1
Sequence:CCGGCCGCAACGATGAGGAGCTCAACTCGAGTTGAGCTCCTCATCGTTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021066
VALIDATED
HIST1H2AJ MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H2aj
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021066.2-280s1c1
Sequence:CCGGCTCAACAAGCTTCTGGGCAAACTCGAGTTTGCCCAGAAGCTTGTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_021066.2-38s1c1
Sequence:CCGGCCAAGGCCAAGACCCGCTCTTCTCGAGAAGAGCGGGTCTTGGCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021066.2-219s1c1
Sequence:CCGGCAACAAGAAGACTCGCATCATCTCGAGATGATGCGAGTCTTCTTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021066.2-100s1c1
Sequence:CCGGCTGCTCCGCAAAGGCAACTATCTCGAGATAGTTGCCTTTGCGGAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_021066.2-264s1c1
Sequence:CCGGCCGCAACGATGAGGAGCTCAACTCGAGTTGAGCTCCTCATCGTTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)