EMAIL THIS PAGE TO A FRIEND

HIST1H2AK

histone cluster 1, H2ak

18 Gene Product Result for
Synonyms: H2A/d H2AFD
Gene ID:
Human(8330) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a member of the histone H2A family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the small histone gene cluster on chromosome 6p22-p21.3. [provided by RefSeq, Jul 2008]
Mouse(319169) histone cluster 1, H2ak
Rat(680615) histone cluster 1, H2ak
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003510 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003510 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003510 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178183 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178183 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178183 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU122541 MISSION® esiRNA esiRNA human HIST1H2AK (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003510 Rosetta Predictions human pricing
NM_178183 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003510 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217686 predicted 39
2 SASI_Hs01_00217687 predicted 416
3 SASI_Hs01_00217688 predicted 405
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178183 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196248 predicted 150
2 SASI_Mm01_00196247 predicted 15
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003510
HIST1H2AK MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H2ak
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003510.2-288s1c1
Sequence:CCGGGCTGCTTGGTAAAGTGACCATCTCGAGATGGTCACTTTACCAAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003510.2-38s1c1
Sequence:CCGGCCAAGGCTAAGACCCGTTCTTCTCGAGAAGAACGGGTCTTAGCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003510.2-280s1c1
Sequence:CCGGCTCAACAAGCTGCTTGGTAAACTCGAGTTTACCAAGCAGCTTGTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003510.2-186s1c1
Sequence:CCGGGATCCTGGAACTGGCTGGCAACTCGAGTTGCCAGCCAGTTCCAGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003510.2-318s21c1
Sequence:CCGGTGGTGTCCTGCCCAATATCCACTCGAGTGGATATTGGGCAGGACACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003510.2-75s21c1
Sequence:CCGGGTTCCCAGTGGGCCGAGTGCACTCGAGTGCACTCGGCCCACTGGGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003510
HIST1H2AK MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H2ak
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003510.2-288s1c1
Sequence:CCGGGCTGCTTGGTAAAGTGACCATCTCGAGATGGTCACTTTACCAAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003510.2-38s1c1
Sequence:CCGGCCAAGGCTAAGACCCGTTCTTCTCGAGAAGAACGGGTCTTAGCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003510.2-280s1c1
Sequence:CCGGCTCAACAAGCTGCTTGGTAAACTCGAGTTTACCAAGCAGCTTGTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003510.2-186s1c1
Sequence:CCGGGATCCTGGAACTGGCTGGCAACTCGAGTTGCCAGCCAGTTCCAGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003510.2-318s21c1
Sequence:CCGGTGGTGTCCTGCCCAATATCCACTCGAGTGGATATTGGGCAGGACACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003510.2-75s21c1
Sequence:CCGGGTTCCCAGTGGGCCGAGTGCACTCGAGTGCACTCGGCCCACTGGGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003510
HIST1H2AK MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H2ak
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003510.2-288s1c1
Sequence:CCGGGCTGCTTGGTAAAGTGACCATCTCGAGATGGTCACTTTACCAAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003510.2-38s1c1
Sequence:CCGGCCAAGGCTAAGACCCGTTCTTCTCGAGAAGAACGGGTCTTAGCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003510.2-280s1c1
Sequence:CCGGCTCAACAAGCTGCTTGGTAAACTCGAGTTTACCAAGCAGCTTGTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003510.2-186s1c1
Sequence:CCGGGATCCTGGAACTGGCTGGCAACTCGAGTTGCCAGCCAGTTCCAGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003510.2-318s21c1
Sequence:CCGGTGGTGTCCTGCCCAATATCCACTCGAGTGGATATTGGGCAGGACACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003510.2-75s21c1
Sequence:CCGGGTTCCCAGTGGGCCGAGTGCACTCGAGTGCACTCGGCCCACTGGGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178183
HIST1H2AK MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H2ak
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000242135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178183.1-219s21c1
Sequence:CCGGCAACAAGAAGACGCGCATTATCTCGAGATAATGCGCGTCTTCTTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178183.1-101s21c1
Sequence:CCGGTGCTCCGCAAAGGCAACTACTCTCGAGAGTAGTTGCCTTTGCGGAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178183.1-112s21c1
Sequence:CCGGGGCAACTACTCGGAGCGCGTGCTCGAGCACGCGCTCCGAGTAGTTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178183.1-168s21c1
Sequence:CCGGAGAGTACCTGACGGCCGAGATCTCGAGATCTCGGCCGTCAGGTACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178183
HIST1H2AK MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H2ak
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000242135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178183.1-219s21c1
Sequence:CCGGCAACAAGAAGACGCGCATTATCTCGAGATAATGCGCGTCTTCTTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178183.1-101s21c1
Sequence:CCGGTGCTCCGCAAAGGCAACTACTCTCGAGAGTAGTTGCCTTTGCGGAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178183.1-112s21c1
Sequence:CCGGGGCAACTACTCGGAGCGCGTGCTCGAGCACGCGCTCCGAGTAGTTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178183.1-168s21c1
Sequence:CCGGAGAGTACCTGACGGCCGAGATCTCGAGATCTCGGCCGTCAGGTACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178183
HIST1H2AK MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H2ak
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000242135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178183.1-219s21c1
Sequence:CCGGCAACAAGAAGACGCGCATTATCTCGAGATAATGCGCGTCTTCTTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178183.1-101s21c1
Sequence:CCGGTGCTCCGCAAAGGCAACTACTCTCGAGAGTAGTTGCCTTTGCGGAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178183.1-112s21c1
Sequence:CCGGGGCAACTACTCGGAGCGCGTGCTCGAGCACGCGCTCCGAGTAGTTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178183.1-168s21c1
Sequence:CCGGAGAGTACCTGACGGCCGAGATCTCGAGATCTCGGCCGTCAGGTACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)