EMAIL THIS PAGE TO A FRIEND

HIST1H2AL

histone cluster 1, H2al

33 Gene Product Result for
Synonyms: H2A.i H2A/i H2AFI dJ193B12.9
Gene ID:
Human(8332) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a member of the histone H2A family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the small histone gene cluster on chromosome 6p22-p21.3. [provided by RefSeq, Jul 2008]
Mouse(667728) histone cluster 1, H2al
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4504674 Anti-phospho-Histone H2A (pThr121) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003511 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003511 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003511 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU112061 MISSION® esiRNA esiRNA human HIST1H2AL (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003511 Rosetta Predictions human pricing
XM_992084 Rosetta Predictions mouse pricing
XR_035232 Rosetta Predictions mouse pricing
XR_035278 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003511 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124547 predicted 417
2 SASI_Hs01_00124548 predicted 75
3 SASI_Hs01_00124550 predicted 408
4 SASI_Hs01_00124551 predicted 324
5 SASI_Hs01_00124553 predicted 73
6 SASI_Hs01_00124549 predicted 405
7 SASI_Hs01_00124555 predicted 401
8 SASI_Hs01_00124552 predicted 405
9 SASI_Hs01_00124554 predicted 416
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_992084 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00207070 predicted 27
2 SASI_Mm01_00207071 predicted 900
3 SASI_Mm01_00207072 predicted 21
4 SASI_Mm01_00207073 predicted 900
5 SASI_Mm01_00207074 predicted 494
6 SASI_Mm01_00207075 predicted 743
7 SASI_Mm01_00207076 predicted 514
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_035232 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00480763 predicted 368
2 SASI_Mm02_00480764 predicted 20
3 SASI_Mm02_00480765 predicted 16
4 SASI_Mm02_00480766 predicted 22
5 SASI_Mm02_00480767 predicted 16
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_035278 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00481206 predicted 371
2 SASI_Mm02_00481207 predicted 22
3 SASI_Mm02_00481208 predicted 18
4 SASI_Mm02_00481209 predicted 17
5 SASI_Mm02_00481210 predicted 13
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003511
HIST1H2AL MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H2al
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000417710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003511.2-399s21c1
Sequence:CCGGCACAAGGCCAAAGGCAAATAACTCGAGTTATTTGCCTTTGGCCTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003511.2-385s21c1
Sequence:CCGGAGACCGAGAGTCACCACAAGGCTCGAGCCTTGTGGTGACTCTCGGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003511.2-64s1c1
Sequence:CCGGCCAAAGCCAAGACCCGCTCTTCTCGAGAAGAGCGGGTCTTGGCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003511.2-126s1c1
Sequence:CCGGCTGCTCCGCAAGGGCAACTATCTCGAGATAGTTGCCCTTGCGGAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003511.2-314s1c1
Sequence:CCGGGCTGCTGGGCAAAGTAACCATCTCGAGATGGTTACTTTGCCCAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003511.2-243s1c1
Sequence:CCGGGACAACAAGAAGACCCGCATTCTCGAGAATGCGGGTCTTCTTGTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003511.2-245s1c1
Sequence:CCGGCAACAAGAAGACCCGCATTATCTCGAGATAATGCGGGTCTTCTTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003511.2-194s21c1
Sequence:CCGGGGAGTACCTGACTGCCGAGATCTCGAGATCTCGGCAGTCAGGTACTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003511
HIST1H2AL MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H2al
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000417710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003511.2-399s21c1
Sequence:CCGGCACAAGGCCAAAGGCAAATAACTCGAGTTATTTGCCTTTGGCCTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003511.2-385s21c1
Sequence:CCGGAGACCGAGAGTCACCACAAGGCTCGAGCCTTGTGGTGACTCTCGGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003511.2-64s1c1
Sequence:CCGGCCAAAGCCAAGACCCGCTCTTCTCGAGAAGAGCGGGTCTTGGCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003511.2-126s1c1
Sequence:CCGGCTGCTCCGCAAGGGCAACTATCTCGAGATAGTTGCCCTTGCGGAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003511.2-314s1c1
Sequence:CCGGGCTGCTGGGCAAAGTAACCATCTCGAGATGGTTACTTTGCCCAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003511.2-243s1c1
Sequence:CCGGGACAACAAGAAGACCCGCATTCTCGAGAATGCGGGTCTTCTTGTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003511.2-245s1c1
Sequence:CCGGCAACAAGAAGACCCGCATTATCTCGAGATAATGCGGGTCTTCTTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003511.2-194s21c1
Sequence:CCGGGGAGTACCTGACTGCCGAGATCTCGAGATCTCGGCAGTCAGGTACTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003511
HIST1H2AL MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H2al
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000417710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003511.2-399s21c1
Sequence:CCGGCACAAGGCCAAAGGCAAATAACTCGAGTTATTTGCCTTTGGCCTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003511.2-385s21c1
Sequence:CCGGAGACCGAGAGTCACCACAAGGCTCGAGCCTTGTGGTGACTCTCGGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003511.2-64s1c1
Sequence:CCGGCCAAAGCCAAGACCCGCTCTTCTCGAGAAGAGCGGGTCTTGGCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003511.2-126s1c1
Sequence:CCGGCTGCTCCGCAAGGGCAACTATCTCGAGATAGTTGCCCTTGCGGAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003511.2-314s1c1
Sequence:CCGGGCTGCTGGGCAAAGTAACCATCTCGAGATGGTTACTTTGCCCAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003511.2-243s1c1
Sequence:CCGGGACAACAAGAAGACCCGCATTCTCGAGAATGCGGGTCTTCTTGTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003511.2-245s1c1
Sequence:CCGGCAACAAGAAGACCCGCATTATCTCGAGATAATGCGGGTCTTCTTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003511.2-194s21c1
Sequence:CCGGGGAGTACCTGACTGCCGAGATCTCGAGATCTCGGCAGTCAGGTACTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)