EMAIL THIS PAGE TO A FRIEND

HIST1H2AM

histone cluster 1, H2am

18 Gene Product Result for
Synonyms: H2A.1 H2A/n H2AFN dJ193B12.1
Species: Human HIST1H2AM(8336)
Gene ID:
Human(8336) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a member of the histone H2A family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the small histone gene cluster on chromosome 6p22-p21.3. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301740 ANTI-HIST1H2AM (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, western blot pricing
SAB4504674 Anti-phospho-Histone H2A (pThr121) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003514 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003514 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003514 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU229501 MISSION® esiRNA esiRNA targeting human HIST1H2AM human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003514 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003514 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066167 predicted 238
2 SASI_Hs01_00066168 predicted 416
3 SASI_Hs01_00066169 predicted 413
4 SASI_Hs01_00066170 predicted 418
5 SASI_Hs01_00066171 predicted 409
6 SASI_Hs01_00066172 predicted 419
7 SASI_Hs01_00066173 predicted 104
8 SASI_Hs01_00066174 predicted 102
9 SASI_Hs01_00066175 predicted 403
10 SASI_Hs01_00066176 predicted 99
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003514
VALIDATED
HIST1H2AM MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H2am
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003514.2-108s1c1
Sequence:CCGGCCAATTTCCTGTAGGACGAGTCTCGAGACTCGTCCTACAGGAAATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003514.2-315s1c1
Sequence:CCGGGCTCAACAAGCTGCTTGGTAACTCGAGTTACCAAGCAGCTTGTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003514.2-324s1c1
Sequence:CCGGGCTGCTTGGTAAAGTTACCATCTCGAGATGGTAACTTTACCAAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_003514.2-317s21c1
Sequence:CCGGTCAACAAGCTGCTTGGTAAAGCTCGAGCTTTACCAAGCAGCTTGTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003514.2-136s21c1
Sequence:CCGGCTGCTCCGCAAGGGCAACTACCTCGAGGTAGTTGCCCTTGCGGAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003514.2-286s21c1
Sequence:CCGGTTGCAGCTGGCCATCCGCAACCTCGAGGTTGCGGATGGCCAGCTGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003514.2-94s21c1
Sequence:CCGGTCTAGAGCTGGGCTCCAATTTCTCGAGAAATTGGAGCCCAGCTCTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_003514.2-302s21c1
Sequence:CCGGGCAACGACGAGGAGCTCAACACTCGAGTGTTGAGCTCCTCGTCGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_003514.2-204s21c1
Sequence:CCGGGGAGTACCTAACTGCCGAGATCTCGAGATCTCGGCAGTTAGGTACTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003514
VALIDATED
HIST1H2AM MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H2am
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003514.2-108s1c1
Sequence:CCGGCCAATTTCCTGTAGGACGAGTCTCGAGACTCGTCCTACAGGAAATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003514.2-315s1c1
Sequence:CCGGGCTCAACAAGCTGCTTGGTAACTCGAGTTACCAAGCAGCTTGTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003514.2-324s1c1
Sequence:CCGGGCTGCTTGGTAAAGTTACCATCTCGAGATGGTAACTTTACCAAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_003514.2-317s21c1
Sequence:CCGGTCAACAAGCTGCTTGGTAAAGCTCGAGCTTTACCAAGCAGCTTGTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003514.2-136s21c1
Sequence:CCGGCTGCTCCGCAAGGGCAACTACCTCGAGGTAGTTGCCCTTGCGGAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003514.2-286s21c1
Sequence:CCGGTTGCAGCTGGCCATCCGCAACCTCGAGGTTGCGGATGGCCAGCTGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003514.2-94s21c1
Sequence:CCGGTCTAGAGCTGGGCTCCAATTTCTCGAGAAATTGGAGCCCAGCTCTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_003514.2-302s21c1
Sequence:CCGGGCAACGACGAGGAGCTCAACACTCGAGTGTTGAGCTCCTCGTCGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_003514.2-204s21c1
Sequence:CCGGGGAGTACCTAACTGCCGAGATCTCGAGATCTCGGCAGTTAGGTACTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003514
VALIDATED
HIST1H2AM MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H2am
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003514.2-108s1c1
Sequence:CCGGCCAATTTCCTGTAGGACGAGTCTCGAGACTCGTCCTACAGGAAATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003514.2-315s1c1
Sequence:CCGGGCTCAACAAGCTGCTTGGTAACTCGAGTTACCAAGCAGCTTGTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003514.2-324s1c1
Sequence:CCGGGCTGCTTGGTAAAGTTACCATCTCGAGATGGTAACTTTACCAAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_003514.2-317s21c1
Sequence:CCGGTCAACAAGCTGCTTGGTAAAGCTCGAGCTTTACCAAGCAGCTTGTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003514.2-136s21c1
Sequence:CCGGCTGCTCCGCAAGGGCAACTACCTCGAGGTAGTTGCCCTTGCGGAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003514.2-286s21c1
Sequence:CCGGTTGCAGCTGGCCATCCGCAACCTCGAGGTTGCGGATGGCCAGCTGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003514.2-94s21c1
Sequence:CCGGTCTAGAGCTGGGCTCCAATTTCTCGAGAAATTGGAGCCCAGCTCTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_003514.2-302s21c1
Sequence:CCGGGCAACGACGAGGAGCTCAACACTCGAGTGTTGAGCTCCTCGTCGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_003514.2-204s21c1
Sequence:CCGGGGAGTACCTAACTGCCGAGATCTCGAGATCTCGGCAGTTAGGTACTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)