EMAIL THIS PAGE TO A FRIEND

HIST1H2BB

histone cluster 1, H2bb

53 Gene Product Result for
Synonyms: H2B.1 H2B/f H2BFF
UniProtKB ID: P33778, Q4KN36
Gene ID:
Human(3018) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a member of the histone H2B family. Transcripts from this gene lack polyA tails; instead, they contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6p22-p21.3. [provided by RefSeq, Jul 2008]
Mouse(319178) histone cluster 1, H2bb
Rat(679910) histone cluster 1, H2bb
cow(525512) histone cluster 1, H2bb
cow(614958) histone cluster 1, H2bn
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021062 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021062 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021062 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175664 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175664 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175664 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021062 Rosetta Predictions human pricing
XM_001054927 Rosetta Predictions rat pricing
NM_175664 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021062 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045632 predicted 361
2 SASI_Hs01_00045633 predicted 337
3 SASI_Hs01_00045634 predicted 367
4 SASI_Hs01_00045635 predicted 42
5 SASI_Hs01_00045636 predicted 344
6 SASI_Hs01_00045637 predicted 338
7 SASI_Hs01_00045639 predicted 359
8 SASI_Hs01_00045640 predicted 333
9 SASI_Hs01_00045641 predicted 389
10 SASI_Hs01_00045638 predicted 389
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054927 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00277748 predicted 40
2 SASI_Rn02_00277749 predicted 27
3 SASI_Rn02_00277750 predicted 106
4 SASI_Rn02_00277751 predicted 37
5 SASI_Rn02_00277752 predicted 28
6 SASI_Rn02_00277753 predicted 105
7 SASI_Rn02_00277754 predicted 318
8 SASI_Rn02_00277755 predicted 368
9 SASI_Rn02_00277756 predicted 39
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175664 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065922 predicted 430
2 SASI_Mm01_00065924 predicted 106
3 SASI_Mm01_00065925 predicted 97
4 SASI_Mm01_00065926 predicted 113
5 SASI_Mm02_00346602 predicted 66
6 SASI_Mm01_00065928 predicted 105
7 SASI_Mm01_00065929 predicted 90
8 SASI_Mm01_00065921 predicted 380
9 SASI_Mm01_00065923 predicted 387
10 SASI_Mm01_00065927 predicted 394
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021062
HIST1H2BB MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H2bb
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021062.2-64s21c1
Sequence:CCGGGCGCAGAAGAAGGATGGTAAGCTCGAGCTTACCATCCTTCTTCTGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021062.2-252s21c1
Sequence:CCGGCAATAAGCGCTCGACCATCACCTCGAGGTGATGGTCGAGCGCTTATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021062.2-360s21c1
Sequence:CCGGCAAGTACACTAGCTCTAAATACTCGAGTATTTAGAGCTAGTGTACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021062.2-159s1c1
Sequence:CCGGCGGCATCTCATCCAAGGCCATCTCGAGATGGCCTTGGATGAGATGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021062.2-237s1c1
Sequence:CCGGTCGCCTGGCTCACTACAATAACTCGAGTTATTGTAGTGAGCCAGGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021062.2-41s1c1
Sequence:CCGGGTTCTAAGAAGGCTATCACTACTCGAGTAGTGATAGCCTTCTTAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021062.2-48s1c1
Sequence:CCGGGAAGGCTATCACTAAGGCGCACTCGAGTGCGCCTTAGTGATAGCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021062.2-108s1c1
Sequence:CCGGGAGCTATTCTATCTATGTGTACTCGAGTACACATAGATAGAATAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021062
HIST1H2BB MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H2bb
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021062.2-64s21c1
Sequence:CCGGGCGCAGAAGAAGGATGGTAAGCTCGAGCTTACCATCCTTCTTCTGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021062.2-252s21c1
Sequence:CCGGCAATAAGCGCTCGACCATCACCTCGAGGTGATGGTCGAGCGCTTATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021062.2-360s21c1
Sequence:CCGGCAAGTACACTAGCTCTAAATACTCGAGTATTTAGAGCTAGTGTACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021062.2-159s1c1
Sequence:CCGGCGGCATCTCATCCAAGGCCATCTCGAGATGGCCTTGGATGAGATGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021062.2-237s1c1
Sequence:CCGGTCGCCTGGCTCACTACAATAACTCGAGTTATTGTAGTGAGCCAGGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021062.2-41s1c1
Sequence:CCGGGTTCTAAGAAGGCTATCACTACTCGAGTAGTGATAGCCTTCTTAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021062.2-48s1c1
Sequence:CCGGGAAGGCTATCACTAAGGCGCACTCGAGTGCGCCTTAGTGATAGCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021062.2-108s1c1
Sequence:CCGGGAGCTATTCTATCTATGTGTACTCGAGTACACATAGATAGAATAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021062
HIST1H2BB MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H2bb
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021062.2-64s21c1
Sequence:CCGGGCGCAGAAGAAGGATGGTAAGCTCGAGCTTACCATCCTTCTTCTGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021062.2-252s21c1
Sequence:CCGGCAATAAGCGCTCGACCATCACCTCGAGGTGATGGTCGAGCGCTTATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021062.2-360s21c1
Sequence:CCGGCAAGTACACTAGCTCTAAATACTCGAGTATTTAGAGCTAGTGTACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021062.2-159s1c1
Sequence:CCGGCGGCATCTCATCCAAGGCCATCTCGAGATGGCCTTGGATGAGATGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021062.2-237s1c1
Sequence:CCGGTCGCCTGGCTCACTACAATAACTCGAGTTATTGTAGTGAGCCAGGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021062.2-41s1c1
Sequence:CCGGGTTCTAAGAAGGCTATCACTACTCGAGTAGTGATAGCCTTCTTAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021062.2-48s1c1
Sequence:CCGGGAAGGCTATCACTAAGGCGCACTCGAGTGCGCCTTAGTGATAGCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021062.2-108s1c1
Sequence:CCGGGAGCTATTCTATCTATGTGTACTCGAGTACACATAGATAGAATAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175664
VALIDATED
HIST1H2BB MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H2bb
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175664.2-171s21c1
Sequence:CCGGGCTATTCGGTGTACGTGTACACTCGAGTGTACACGTACACCGAATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175664.2-182s21c1
Sequence:CCGGTACGTGTACAAGGTGCTGAAGCTCGAGCTTCAGCACCTTGTACACGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175664.2-104s21c1
Sequence:CCGGTCTAAGAAAGCCATCTCTAAGCTCGAGCTTAGAGATGGCTTTCTTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175664.2-93s21c1
Sequence:CCGGCTAAGAAGGGATCTAAGAAAGCTCGAGCTTTCTTAGATCCCTTCTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175664.2-127s21c1
Sequence:CCGGGCAGAAGAAGGATGGCAAGAACTCGAGTTCTTGCCATCCTTCTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175664.2-157s21c1
Sequence:CCGGCAGCCGCAAGGAGAGCTATTCCTCGAGGAATAGCTCTCCTTGCGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175664.1-36s1c1
Sequence:CCGGGAAGGGATCTAAGAAAGCCATCTCGAGATGGCTTTCTTAGATCCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175664.1-54s1c1
Sequence:CCGGCATCTCTAAGGCGCAGAAGAACTCGAGTTCTTCTGCGCCTTAGAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175664.1-41s1c1
Sequence:CCGGGATCTAAGAAAGCCATCTCTACTCGAGTAGAGATGGCTTTCTTAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175664.1-193s1c1
Sequence:CCGGTCGTTCGTGAACGACATCTTTCTCGAGAAAGATGTCGTTCACGAACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175664.1-201s1c1
Sequence:CCGGGAACGACATCTTTGAGCGCATCTCGAGATGCGCTCAAAGATGTCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175664
VALIDATED
HIST1H2BB MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H2bb
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175664.2-171s21c1
Sequence:CCGGGCTATTCGGTGTACGTGTACACTCGAGTGTACACGTACACCGAATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175664.2-182s21c1
Sequence:CCGGTACGTGTACAAGGTGCTGAAGCTCGAGCTTCAGCACCTTGTACACGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175664.2-104s21c1
Sequence:CCGGTCTAAGAAAGCCATCTCTAAGCTCGAGCTTAGAGATGGCTTTCTTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175664.2-93s21c1
Sequence:CCGGCTAAGAAGGGATCTAAGAAAGCTCGAGCTTTCTTAGATCCCTTCTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175664.2-127s21c1
Sequence:CCGGGCAGAAGAAGGATGGCAAGAACTCGAGTTCTTGCCATCCTTCTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175664.2-157s21c1
Sequence:CCGGCAGCCGCAAGGAGAGCTATTCCTCGAGGAATAGCTCTCCTTGCGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175664.1-36s1c1
Sequence:CCGGGAAGGGATCTAAGAAAGCCATCTCGAGATGGCTTTCTTAGATCCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175664.1-54s1c1
Sequence:CCGGCATCTCTAAGGCGCAGAAGAACTCGAGTTCTTCTGCGCCTTAGAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175664.1-41s1c1
Sequence:CCGGGATCTAAGAAAGCCATCTCTACTCGAGTAGAGATGGCTTTCTTAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175664.1-193s1c1
Sequence:CCGGTCGTTCGTGAACGACATCTTTCTCGAGAAAGATGTCGTTCACGAACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175664.1-201s1c1
Sequence:CCGGGAACGACATCTTTGAGCGCATCTCGAGATGCGCTCAAAGATGTCGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175664
VALIDATED
HIST1H2BB MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H2bb
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175664.2-171s21c1
Sequence:CCGGGCTATTCGGTGTACGTGTACACTCGAGTGTACACGTACACCGAATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175664.2-182s21c1
Sequence:CCGGTACGTGTACAAGGTGCTGAAGCTCGAGCTTCAGCACCTTGTACACGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175664.2-104s21c1
Sequence:CCGGTCTAAGAAAGCCATCTCTAAGCTCGAGCTTAGAGATGGCTTTCTTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175664.2-93s21c1
Sequence:CCGGCTAAGAAGGGATCTAAGAAAGCTCGAGCTTTCTTAGATCCCTTCTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175664.2-127s21c1
Sequence:CCGGGCAGAAGAAGGATGGCAAGAACTCGAGTTCTTGCCATCCTTCTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175664.2-157s21c1
Sequence:CCGGCAGCCGCAAGGAGAGCTATTCCTCGAGGAATAGCTCTCCTTGCGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175664.1-36s1c1
Sequence:CCGGGAAGGGATCTAAGAAAGCCATCTCGAGATGGCTTTCTTAGATCCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175664.1-54s1c1
Sequence:CCGGCATCTCTAAGGCGCAGAAGAACTCGAGTTCTTCTGCGCCTTAGAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175664.1-41s1c1
Sequence:CCGGGATCTAAGAAAGCCATCTCTACTCGAGTAGAGATGGCTTTCTTAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175664.1-193s1c1
Sequence:CCGGTCGTTCGTGAACGACATCTTTCTCGAGAAAGATGTCGTTCACGAACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175664.1-201s1c1
Sequence:CCGGGAACGACATCTTTGAGCGCATCTCGAGATGCGCTCAAAGATGTCGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)