EMAIL THIS PAGE TO A FRIEND

HIST1H2BC

histone cluster 1, H2bc

54 Gene Product Result for
Synonyms: H2B.1 H2B/l H2BFL dJ221C16.3
UniProtKB ID: P62807, P02278, Q3B872, Q4VB69, Q93078, Q93080
Gene ID:
Human(8347) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a member of the histone H2B family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6. [provided by RefSeq, Jul 2008]
Mouse(68024) histone cluster 1, H2bc
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023422 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023422 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023422 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003526 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003526 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003526 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003526 Rosetta Predictions human pricing
NM_023422 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003526 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ?
1 SASI_Hs01_00214261 predicted 385
2 SASI_Hs01_00214262 predicted 98
3 SASI_Hs01_00214263 predicted 102
4 SASI_Hs01_00214264 predicted 373
5 SASI_Hs01_00214265 predicted 43
6 SASI_Hs01_00214266 predicted 45
7 SASI_Hs01_00214267 predicted 383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023422 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ?
1 SASI_Mm01_00061665 predicted 488
2 SASI_Mm01_00061666 predicted 479
3 SASI_Mm01_00061667 predicted 434
4 SASI_Mm02_00327113 predicted 467
5 SASI_Mm01_00061668 predicted 424
6 SASI_Mm01_00061669 predicted 485
7 SASI_Mm01_00061671 predicted 496
8 SASI_Mm01_00061672 predicted 419
9 SASI_Mm01_00061673 predicted 433
10 SASI_Mm01_00061674 predicted 490
11 SASI_Mm01_00061670 predicted 417
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023422
VALIDATED
HIST1H2BC MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H2bc
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023422.1-433s1c1
Sequence:CCGGGACATCGTTTGTACCACTCAACTCGAGTTGAGTGGTACAAACGATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023422.1-533s1c1
Sequence:CCGGGAACAACTGAGAAGCACCATTCTCGAGAATGGTGCTTCTCAGTTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023422.1-518s1c1
Sequence:CCGGGTTTCAGAACTCAAGGAACAACTCGAGTTGTTCCTTGAGTTCTGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023422.1-524s1c1
Sequence:CCGGGAACTCAAGGAACAACTGAGACTCGAGTCTCAGTTGTTCCTTGAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279005    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023422.3-494s21c1
Sequence:CCGGGGGTGATACTAGCAGATTAACCTCGAGGTTAATCTGCTAGTATCACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279004    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023422.3-463s21c1
Sequence:CCGGCTGGATGCTGTAACCTCAAGACTCGAGTCTTGAGGTTACAGCATCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023422.3-522s21c1
Sequence:CCGGGTTTCAGAACTCAAGGAACAACTCGAGTTGTTCCTTGAGTTCTGAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279069    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023422.3-537s21c1
Sequence:CCGGGAACAACTGAGAAGCACCATTCTCGAGAATGGTGCTTCTCAGTTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023422.3-397s21c1
Sequence:CCGGTACACCAGCTCCAAGTGATCCCTCGAGGGATCACTTGGAGCTGGTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023422
VALIDATED
HIST1H2BC MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H2bc
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023422.1-433s1c1
Sequence:CCGGGACATCGTTTGTACCACTCAACTCGAGTTGAGTGGTACAAACGATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023422.1-533s1c1
Sequence:CCGGGAACAACTGAGAAGCACCATTCTCGAGAATGGTGCTTCTCAGTTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023422.1-518s1c1
Sequence:CCGGGTTTCAGAACTCAAGGAACAACTCGAGTTGTTCCTTGAGTTCTGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023422.1-524s1c1
Sequence:CCGGGAACTCAAGGAACAACTGAGACTCGAGTCTCAGTTGTTCCTTGAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279005    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023422.3-494s21c1
Sequence:CCGGGGGTGATACTAGCAGATTAACCTCGAGGTTAATCTGCTAGTATCACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279004    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023422.3-463s21c1
Sequence:CCGGCTGGATGCTGTAACCTCAAGACTCGAGTCTTGAGGTTACAGCATCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023422.3-522s21c1
Sequence:CCGGGTTTCAGAACTCAAGGAACAACTCGAGTTGTTCCTTGAGTTCTGAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279069    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023422.3-537s21c1
Sequence:CCGGGAACAACTGAGAAGCACCATTCTCGAGAATGGTGCTTCTCAGTTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023422.3-397s21c1
Sequence:CCGGTACACCAGCTCCAAGTGATCCCTCGAGGGATCACTTGGAGCTGGTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023422
VALIDATED
HIST1H2BC MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H2bc
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023422.1-433s1c1
Sequence:CCGGGACATCGTTTGTACCACTCAACTCGAGTTGAGTGGTACAAACGATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023422.1-533s1c1
Sequence:CCGGGAACAACTGAGAAGCACCATTCTCGAGAATGGTGCTTCTCAGTTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023422.1-518s1c1
Sequence:CCGGGTTTCAGAACTCAAGGAACAACTCGAGTTGTTCCTTGAGTTCTGAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023422.1-524s1c1
Sequence:CCGGGAACTCAAGGAACAACTGAGACTCGAGTCTCAGTTGTTCCTTGAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279005    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023422.3-494s21c1
Sequence:CCGGGGGTGATACTAGCAGATTAACCTCGAGGTTAATCTGCTAGTATCACCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279004    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023422.3-463s21c1
Sequence:CCGGCTGGATGCTGTAACCTCAAGACTCGAGTCTTGAGGTTACAGCATCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023422.3-522s21c1
Sequence:CCGGGTTTCAGAACTCAAGGAACAACTCGAGTTGTTCCTTGAGTTCTGAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279069    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023422.3-537s21c1
Sequence:CCGGGAACAACTGAGAAGCACCATTCTCGAGAATGGTGCTTCTCAGTTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023422.3-397s21c1
Sequence:CCGGTACACCAGCTCCAAGTGATCCCTCGAGGGATCACTTGGAGCTGGTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003526
HIST1H2BC MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H2bc
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003526.2-201s1c1
Sequence:CCGGTAACGACATATTTGAGCGCATCTCGAGATGCGCTCAAATATGTCGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003526.2-66s1c1
Sequence:CCGGGCAGAAGAAAGATGGCAAGAACTCGAGTTCTTGCCATCTTTCTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003526.2-182s1c1
Sequence:CCGGGCATCATGAATTCTTTCGTTACTCGAGTAACGAAAGAATTCATGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003526.2-102s1c1
Sequence:CCGGCAAGGAGAGTTACTCTGTGTACTCGAGTACACAGAGTAACTCTCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003526.2-55s1c1
Sequence:CCGGGTGACCAAAGCGCAGAAGAAACTCGAGTTTCTTCTGCGCTTTGGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003526.2-251s21c1
Sequence:CCGGACAACAAGCGCTCGACCATCACTCGAGTGATGGTCGAGCGCTTGTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003526.2-168s21c1
Sequence:CCGGTTCCAAGGCCATGGGCATCATCTCGAGATGATGCCCATGGCCTTGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003526.2-149s21c1
Sequence:CCGGATCCCGACACTGGCATCTCTTCTCGAGAAGAGATGCCAGTGTCGGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003526
HIST1H2BC MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H2bc
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003526.2-201s1c1
Sequence:CCGGTAACGACATATTTGAGCGCATCTCGAGATGCGCTCAAATATGTCGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003526.2-66s1c1
Sequence:CCGGGCAGAAGAAAGATGGCAAGAACTCGAGTTCTTGCCATCTTTCTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003526.2-182s1c1
Sequence:CCGGGCATCATGAATTCTTTCGTTACTCGAGTAACGAAAGAATTCATGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003526.2-102s1c1
Sequence:CCGGCAAGGAGAGTTACTCTGTGTACTCGAGTACACAGAGTAACTCTCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003526.2-55s1c1
Sequence:CCGGGTGACCAAAGCGCAGAAGAAACTCGAGTTTCTTCTGCGCTTTGGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003526.2-251s21c1
Sequence:CCGGACAACAAGCGCTCGACCATCACTCGAGTGATGGTCGAGCGCTTGTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000440968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003526.2-168s21c1
Sequence:CCGGTTCCAAGGCCATGGGCATCATCTCGAGATGATGCCCATGGCCTTGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003526.2-149s21c1
Sequence:CCGGATCCCGACACTGGCATCTCTTCTCGAGAAGAGATGCCAGTGTCGGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003526
HIST1H2BC MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H2bc
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003526.2-201s1c1
Sequence:CCGGTAACGACATATTTGAGCGCATCTCGAGATGCGCTCAAATATGTCGTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003526.2-66s1c1
Sequence:CCGGGCAGAAGAAAGATGGCAAGAACTCGAGTTCTTGCCATCTTTCTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003526.2-182s1c1
Sequence:CCGGGCATCATGAATTCTTTCGTTACTCGAGTAACGAAAGAATTCATGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003526.2-102s1c1
Sequence:CCGGCAAGGAGAGTTACTCTGTGTACTCGAGTACACAGAGTAACTCTCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003526.2-55s1c1
Sequence:CCGGGTGACCAAAGCGCAGAAGAAACTCGAGTTTCTTCTGCGCTTTGGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003526.2-251s21c1
Sequence:CCGGACAACAAGCGCTCGACCATCACTCGAGTGATGGTCGAGCGCTTGTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003526.2-168s21c1
Sequence:CCGGTTCCAAGGCCATGGGCATCATCTCGAGATGATGCCCATGGCCTTGGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003526.2-149s21c1
Sequence:CCGGATCCCGACACTGGCATCTCTTCTCGAGAAGAGATGCCAGTGTCGGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)