EMAIL THIS PAGE TO A FRIEND

HIST1H2BD

histone cluster 1, H2bd

36 Gene Product Result for
Synonyms: H2B.1B H2B/b H2BFB HIRIP2 dJ221C16.6
UniProtKB ID: P58876
Gene ID:
Human(3017) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a member of the histone H2B family. Two transcripts that encode the same protein have been identified for this gene, which is found in the large histone gene cluster on chromosome 6p22-p21.3. [provided by RefSeq, Jul 2008]
Rat(361247) histone cluster 1, H2bd
cow(519935) histone cluster 1, H2bd
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302706 ANTI-HIST1H2BD (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2700101 Anti-HIST1H2BD antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138720 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138720 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138720 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU110151 MISSION® esiRNA esiRNA human HIST1H2BD (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021063 Rosetta Predictions human pricing
NM_138720 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021063 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100172 predicted 110
2 SASI_Hs01_00100173 predicted 154
3 SASI_Hs01_00100174 predicted 435
4 SASI_Hs01_00100175 predicted 149
5 SASI_Hs01_00100176 predicted 408
6 SASI_Hs01_00100177 predicted 150
7 SASI_Hs01_00100178 predicted 433
8 SASI_Hs01_00100179 predicted 154
9 SASI_Hs01_00100180 predicted 416
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138720 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157792 predicted 425
2 SASI_Hs01_00157793 predicted 510
3 SASI_Hs01_00157794 predicted 442
4 SASI_Hs01_00157795 predicted 494
5 SASI_Hs01_00157796 predicted 446
6 SASI_Hs01_00157797 predicted 534
7 SASI_Hs01_00157791 predicted 457
8 SASI_Hs01_00157798 predicted 537
9 SASI_Hs01_00157799 predicted 443
10 SASI_Hs01_00157800 predicted 506
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138720
HIST1H2BD MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H2bd
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138720.1-625s21c1
Sequence:CCGGGGTGTTTGCACTTCATGTTACCTCGAGGTAACATGAAGTGCAAACACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138720.1-424s21c1
Sequence:CCGGCAAGTAACTTTGCCAAGGGAGCTCGAGCTCCCTTGGCAAAGTTACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138720.1-415s21c1
Sequence:CCGGCACCAGTTCCAAGTAACTTTGCTCGAGCAAAGTTACTTGGAACTGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106830    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138720.1-679s1c1
Sequence:CCGGCTTCTGTTACAGACCTAGTTACTCGAGTAACTAGGTCTGTAACAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138720.1-151s1c1
Sequence:CCGGCAAGGAGAGCTATTCAGTGTACTCGAGTACACTGAATAGCTCTCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138720.1-208s1c1
Sequence:CCGGCGGCATCTCTTCCAAGGCAATCTCGAGATTGCCTTGGAAGAGATGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138720.1-406s1c1
Sequence:CCGGCACCAAGTACACCAGTTCCAACTCGAGTTGGAACTGGTGTACTTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138720
HIST1H2BD MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H2bd
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138720.1-625s21c1
Sequence:CCGGGGTGTTTGCACTTCATGTTACCTCGAGGTAACATGAAGTGCAAACACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138720.1-424s21c1
Sequence:CCGGCAAGTAACTTTGCCAAGGGAGCTCGAGCTCCCTTGGCAAAGTTACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138720.1-415s21c1
Sequence:CCGGCACCAGTTCCAAGTAACTTTGCTCGAGCAAAGTTACTTGGAACTGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106830    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138720.1-679s1c1
Sequence:CCGGCTTCTGTTACAGACCTAGTTACTCGAGTAACTAGGTCTGTAACAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138720.1-151s1c1
Sequence:CCGGCAAGGAGAGCTATTCAGTGTACTCGAGTACACTGAATAGCTCTCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138720.1-208s1c1
Sequence:CCGGCGGCATCTCTTCCAAGGCAATCTCGAGATTGCCTTGGAAGAGATGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138720.1-406s1c1
Sequence:CCGGCACCAAGTACACCAGTTCCAACTCGAGTTGGAACTGGTGTACTTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138720
HIST1H2BD MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H2bd
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138720.1-625s21c1
Sequence:CCGGGGTGTTTGCACTTCATGTTACCTCGAGGTAACATGAAGTGCAAACACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138720.1-424s21c1
Sequence:CCGGCAAGTAACTTTGCCAAGGGAGCTCGAGCTCCCTTGGCAAAGTTACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138720.1-415s21c1
Sequence:CCGGCACCAGTTCCAAGTAACTTTGCTCGAGCAAAGTTACTTGGAACTGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106830    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138720.1-679s1c1
Sequence:CCGGCTTCTGTTACAGACCTAGTTACTCGAGTAACTAGGTCTGTAACAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138720.1-151s1c1
Sequence:CCGGCAAGGAGAGCTATTCAGTGTACTCGAGTACACTGAATAGCTCTCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138720.1-208s1c1
Sequence:CCGGCGGCATCTCTTCCAAGGCAATCTCGAGATTGCCTTGGAAGAGATGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138720.1-406s1c1
Sequence:CCGGCACCAAGTACACCAGTTCCAACTCGAGTTGGAACTGGTGTACTTGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)