EMAIL THIS PAGE TO A FRIEND

HIST1H2BE

histone cluster 1, H2be

24 Gene Product Result for
Synonyms: H2B.h H2B/h H2BFH dJ221C16.8
Gene ID:
Human(8344) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a member of the histone H2B family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6. [provided by RefSeq, Jul 2008]
Mouse(319179) histone cluster 1, H2be
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003523 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003523 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003523 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178194 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178194 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178194 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003523 Rosetta Predictions human pricing
NM_178194 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003523 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088866 predicted 382
2 SASI_Hs01_00088864 predicted 382
3 SASI_Hs01_00088865 predicted 380
4 SASI_Hs01_00088868 predicted 386
5 SASI_Hs01_00088867 predicted 321
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178194 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187248 predicted 693
2 SASI_Mm02_00348611 predicted 967
3 SASI_Mm01_00187249 predicted 726
4 SASI_Mm01_00187250 predicted 833
5 SASI_Mm01_00187251 predicted 997
6 SASI_Mm01_00187252 predicted 1058
7 SASI_Mm01_00187253 predicted 692
8 SASI_Mm01_00187255 predicted 752
9 SASI_Mm01_00187256 predicted 730
10 SASI_Mm01_00187257 predicted 666
11 SASI_Mm01_00187254 predicted 814
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003523
VALIDATED
HIST1H2BE MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H2be
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003523.2-183s1c1
Sequence:CCGGGATCATGAATTCCTTTGTCAACTCGAGTTGACAAAGGAATTCATGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003523.2-189s1c1
Sequence:CCGGGAATTCCTTTGTCAACGACATCTCGAGATGTCGTTGACAAAGGAATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003523.2-54s1c1
Sequence:CCGGCGTGACCAAGGCGCAGAAGAACTCGAGTTCTTCTGCGCCTTGGTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003523.2-159s1c1
Sequence:CCGGCGGCATCTCCTCTAAAGCCATCTCGAGATGGCTTTAGAGGAGATGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003523.2-111s1c1
Sequence:CCGGCTACTCCGTATACGTGTACAACTCGAGTTGTACACGTATACGGAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003523
VALIDATED
HIST1H2BE MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H2be
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003523.2-183s1c1
Sequence:CCGGGATCATGAATTCCTTTGTCAACTCGAGTTGACAAAGGAATTCATGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003523.2-189s1c1
Sequence:CCGGGAATTCCTTTGTCAACGACATCTCGAGATGTCGTTGACAAAGGAATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003523.2-54s1c1
Sequence:CCGGCGTGACCAAGGCGCAGAAGAACTCGAGTTCTTCTGCGCCTTGGTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003523.2-159s1c1
Sequence:CCGGCGGCATCTCCTCTAAAGCCATCTCGAGATGGCTTTAGAGGAGATGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003523.2-111s1c1
Sequence:CCGGCTACTCCGTATACGTGTACAACTCGAGTTGTACACGTATACGGAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003523
VALIDATED
HIST1H2BE MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H2be
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003523.2-183s1c1
Sequence:CCGGGATCATGAATTCCTTTGTCAACTCGAGTTGACAAAGGAATTCATGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003523.2-189s1c1
Sequence:CCGGGAATTCCTTTGTCAACGACATCTCGAGATGTCGTTGACAAAGGAATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003523.2-54s1c1
Sequence:CCGGCGTGACCAAGGCGCAGAAGAACTCGAGTTCTTCTGCGCCTTGGTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003523.2-159s1c1
Sequence:CCGGCGGCATCTCCTCTAAAGCCATCTCGAGATGGCTTTAGAGGAGATGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003523.2-111s1c1
Sequence:CCGGCTACTCCGTATACGTGTACAACTCGAGTTGTACACGTATACGGAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178194
HIST1H2BE MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H2be
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096944    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178194.2-698s1c1
Sequence:CCGGCCACCTTTATATGGTTCTTTACTCGAGTAAAGAACCATATAAAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178194.2-578s1c1
Sequence:CCGGCACCAAGTACACCAGCTCCAACTCGAGTTGGAGCTGGTGTACTTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178194.2-485s1c1
Sequence:CCGGGACCATCACATCCCGGGAGATCTCGAGATCTCCCGGGATGTGATGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178194.2-262s1c1
Sequence:CCGGGCTCCAAGAAGGCTGTCACCACTCGAGTGGTGACAGCCTTCTTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178194.2-568s1c1
Sequence:CCGGCCAAGGCTGTCACCAAGTACACTCGAGTGTACTTGGTGACAGCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178194
HIST1H2BE MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H2be
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096944    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178194.2-698s1c1
Sequence:CCGGCCACCTTTATATGGTTCTTTACTCGAGTAAAGAACCATATAAAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178194.2-578s1c1
Sequence:CCGGCACCAAGTACACCAGCTCCAACTCGAGTTGGAGCTGGTGTACTTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178194.2-485s1c1
Sequence:CCGGGACCATCACATCCCGGGAGATCTCGAGATCTCCCGGGATGTGATGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178194.2-262s1c1
Sequence:CCGGGCTCCAAGAAGGCTGTCACCACTCGAGTGGTGACAGCCTTCTTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178194.2-568s1c1
Sequence:CCGGCCAAGGCTGTCACCAAGTACACTCGAGTGTACTTGGTGACAGCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178194
HIST1H2BE MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H2be
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096944    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178194.2-698s1c1
Sequence:CCGGCCACCTTTATATGGTTCTTTACTCGAGTAAAGAACCATATAAAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178194.2-578s1c1
Sequence:CCGGCACCAAGTACACCAGCTCCAACTCGAGTTGGAGCTGGTGTACTTGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178194.2-485s1c1
Sequence:CCGGGACCATCACATCCCGGGAGATCTCGAGATCTCCCGGGATGTGATGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178194.2-262s1c1
Sequence:CCGGGCTCCAAGAAGGCTGTCACCACTCGAGTGGTGACAGCCTTCTTGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178194.2-568s1c1
Sequence:CCGGCCAAGGCTGTCACCAAGTACACTCGAGTGTACTTGGTGACAGCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)