EMAIL THIS PAGE TO A FRIEND

HIST1H2BG

histone cluster 1, H2bg

31 Gene Product Result for
Synonyms: H2B.1A H2B/a H2BFA dJ221C16.8
Gene ID:
Human(8339) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a member of the histone H2B family. Transcripts from this gene lack polyA tails; instead, they contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6p22-p21.3. [provided by RefSeq, Jul 2008]
Mouse(319181) histone cluster 1, H2bg
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178196 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178196 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178196 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003518 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003518 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003518 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003518 Rosetta Predictions human pricing
NM_178196 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003518 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040927 predicted 360
2 SASI_Hs01_00040928 predicted 28
3 SASI_Hs01_00040929 predicted 378
4 SASI_Hs01_00040930 predicted 11
5 SASI_Hs01_00040931 predicted 376
6 SASI_Hs01_00040932 predicted 334
7 SASI_Hs01_00040933 predicted 322
8 SASI_Hs01_00040934 predicted 152
9 SASI_Hs01_00040935 predicted 367
10 SASI_Hs01_00040936 predicted 370
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178196 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106592 predicted 542
2 SASI_Mm01_00106593 predicted 543
3 SASI_Mm01_00106594 predicted 488
4 SASI_Mm01_00106595 predicted 570
5 SASI_Mm01_00106596 predicted 501
6 SASI_Mm01_00106597 predicted 483
7 SASI_Mm01_00106598 predicted 533
8 SASI_Mm01_00106599 predicted 496
9 SASI_Mm01_00106600 predicted 547
10 SASI_Mm01_00106601 predicted 523
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178196
VALIDATED
HIST1H2BG MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H2bg
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178196.3-145s21c1
Sequence:CCGGTACTCGGTGTACGTGTACAAGCTCGAGCTTGTACACGTACACCGAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178196.3-282s21c1
Sequence:CCGGTTACAACAAGCGCTCGACCATCTCGAGATGGTCGAGCGCTTGTTGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178196.3-469s21c1
Sequence:CCGGGTCACTTTAAGTGCTTTGTAACTCGAGTTACAAAGCACTTAAAGTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178196.3-227s21c1
Sequence:CCGGCGTTCGTGAACGACATCTTCGCTCGAGCGAAGATGTCGTTCACGAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433422    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178196.3-480s21c1
Sequence:CCGGTGCTTTGTAATGCTTGGCTTTCTCGAGAAAGCCAAGCATTACAAAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178196.3-431s21c1
Sequence:CCGGCTCCTAACCCAAAGGCTCTTTCTCGAGAAAGAGCCTTTGGGTTAGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178196.3-100s21c1
Sequence:CCGGCAGAAGAAGGACGGCAAGAAGCTCGAGCTTCTTGCCGTCCTTCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096949    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178196.2-485s1c1
Sequence:CCGGCCACCCATACTGTCACTTTAACTCGAGTTAAAGTGACAGTATGGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178196.2-114s1c1
Sequence:CCGGCGTGACCAAGGCCCAGAAGAACTCGAGTTCTTCTGGGCCTTGGTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178196.2-413s1c1
Sequence:CCGGCTGTCACTAAGTACACCAGCTCTCGAGAGCTGGTGTACTTAGTGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178196.2-417s1c1
Sequence:CCGGCACTAAGTACACCAGCTCCAACTCGAGTTGGAGCTGGTGTACTTAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431910    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178196.3-419s21c1
Sequence:CCGGATTTAACTCACACTCCTAACCCTCGAGGGTTAGGAGTGTGAGTTAAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178196.3-213s21c1
Sequence:CCGGGGGCATCATGAACTCGTTCGTCTCGAGACGAACGAGTTCATGATGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178196.2-407s1c1
Sequence:CCGGCCAAGGCTGTCACTAAGTACACTCGAGTGTACTTAGTGACAGCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178196
VALIDATED
HIST1H2BG MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H2bg
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178196.3-145s21c1
Sequence:CCGGTACTCGGTGTACGTGTACAAGCTCGAGCTTGTACACGTACACCGAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178196.3-282s21c1
Sequence:CCGGTTACAACAAGCGCTCGACCATCTCGAGATGGTCGAGCGCTTGTTGTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178196.3-469s21c1
Sequence:CCGGGTCACTTTAAGTGCTTTGTAACTCGAGTTACAAAGCACTTAAAGTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178196.3-227s21c1
Sequence:CCGGCGTTCGTGAACGACATCTTCGCTCGAGCGAAGATGTCGTTCACGAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433422    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178196.3-480s21c1
Sequence:CCGGTGCTTTGTAATGCTTGGCTTTCTCGAGAAAGCCAAGCATTACAAAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000442838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178196.3-431s21c1
Sequence:CCGGCTCCTAACCCAAAGGCTCTTTCTCGAGAAAGAGCCTTTGGGTTAGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178196.3-100s21c1
Sequence:CCGGCAGAAGAAGGACGGCAAGAAGCTCGAGCTTCTTGCCGTCCTTCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096949    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178196.2-485s1c1
Sequence:CCGGCCACCCATACTGTCACTTTAACTCGAGTTAAAGTGACAGTATGGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178196.2-114s1c1
Sequence:CCGGCGTGACCAAGGCCCAGAAGAACTCGAGTTCTTCTGGGCCTTGGTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178196.2-413s1c1
Sequence:CCGGCTGTCACTAAGTACACCAGCTCTCGAGAGCTGGTGTACTTAGTGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178196.2-417s1c1
Sequence:CCGGCACTAAGTACACCAGCTCCAACTCGAGTTGGAGCTGGTGTACTTAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431910    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178196.3-419s21c1
Sequence:CCGGATTTAACTCACACTCCTAACCCTCGAGGGTTAGGAGTGTGAGTTAAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178196.3-213s21c1
Sequence:CCGGGGGCATCATGAACTCGTTCGTCTCGAGACGAACGAGTTCATGATGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178196.2-407s1c1
Sequence:CCGGCCAAGGCTGTCACTAAGTACACTCGAGTGTACTTAGTGACAGCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178196
VALIDATED
HIST1H2BG MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H2bg
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178196.3-145s21c1
Sequence:CCGGTACTCGGTGTACGTGTACAAGCTCGAGCTTGTACACGTACACCGAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178196.3-282s21c1
Sequence:CCGGTTACAACAAGCGCTCGACCATCTCGAGATGGTCGAGCGCTTGTTGTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178196.3-469s21c1
Sequence:CCGGGTCACTTTAAGTGCTTTGTAACTCGAGTTACAAAGCACTTAAAGTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178196.3-227s21c1
Sequence:CCGGCGTTCGTGAACGACATCTTCGCTCGAGCGAAGATGTCGTTCACGAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433422    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178196.3-480s21c1
Sequence:CCGGTGCTTTGTAATGCTTGGCTTTCTCGAGAAAGCCAAGCATTACAAAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178196.3-431s21c1
Sequence:CCGGCTCCTAACCCAAAGGCTCTTTCTCGAGAAAGAGCCTTTGGGTTAGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178196.3-100s21c1
Sequence:CCGGCAGAAGAAGGACGGCAAGAAGCTCGAGCTTCTTGCCGTCCTTCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096949    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178196.2-485s1c1
Sequence:CCGGCCACCCATACTGTCACTTTAACTCGAGTTAAAGTGACAGTATGGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178196.2-114s1c1
Sequence:CCGGCGTGACCAAGGCCCAGAAGAACTCGAGTTCTTCTGGGCCTTGGTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178196.2-413s1c1
Sequence:CCGGCTGTCACTAAGTACACCAGCTCTCGAGAGCTGGTGTACTTAGTGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178196.2-417s1c1
Sequence:CCGGCACTAAGTACACCAGCTCCAACTCGAGTTGGAGCTGGTGTACTTAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431910    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178196.3-419s21c1
Sequence:CCGGATTTAACTCACACTCCTAACCCTCGAGGGTTAGGAGTGTGAGTTAAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178196.3-213s21c1
Sequence:CCGGGGGCATCATGAACTCGTTCGTCTCGAGACGAACGAGTTCATGATGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178196.2-407s1c1
Sequence:CCGGCCAAGGCTGTCACTAAGTACACTCGAGTGTACTTAGTGACAGCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003518
HIST1H2BG MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H2bg
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003518.3-352s21c1
Sequence:CCGGGGCTGTCACCAAGTATACAAGCTCGAGCTTGTATACTTGGTGACAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003518.3-40s21c1
Sequence:CCGGGGGTTCCAAGAAGGCTGTGACCTCGAGGTCACAGCCTTCTTGGAACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003518.3-199s21c1
Sequence:CCGGCGTTAACGACATCTTCGAACGCTCGAGCGTTCGAAGATGTCGTTAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003518.3-121s1c1
Sequence:CCGGGTATGTGTACAAGGTGCTAAACTCGAGTTTAGCACCTTGTACACATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003518.3-85s21c1
Sequence:CCGGGAAGCGCAAGCGCAGTCGTAACTCGAGTTACGACTGCGCTTGCGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003518.3-183s1c1
Sequence:CCGGGCATCATGAATTCCTTCGTTACTCGAGTAACGAAGGAATTCATGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003518.3-94s1c1
Sequence:CCGGGCGCAGTCGTAAGGAGAGCTACTCGAGTAGCTCTCCTTACGACTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003518.3-67s1c1
Sequence:CCGGGCAGAAGAAGGATGGCAAGAACTCGAGTTCTTGCCATCCTTCTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003518.3-154s1c1
Sequence:CCGGCGATACTGGCATCTCATCCAACTCGAGTTGGATGAGATGCCAGTATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003518
HIST1H2BG MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H2bg
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003518.3-352s21c1
Sequence:CCGGGGCTGTCACCAAGTATACAAGCTCGAGCTTGTATACTTGGTGACAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003518.3-40s21c1
Sequence:CCGGGGGTTCCAAGAAGGCTGTGACCTCGAGGTCACAGCCTTCTTGGAACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003518.3-199s21c1
Sequence:CCGGCGTTAACGACATCTTCGAACGCTCGAGCGTTCGAAGATGTCGTTAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003518.3-121s1c1
Sequence:CCGGGTATGTGTACAAGGTGCTAAACTCGAGTTTAGCACCTTGTACACATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003518.3-85s21c1
Sequence:CCGGGAAGCGCAAGCGCAGTCGTAACTCGAGTTACGACTGCGCTTGCGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003518.3-183s1c1
Sequence:CCGGGCATCATGAATTCCTTCGTTACTCGAGTAACGAAGGAATTCATGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003518.3-94s1c1
Sequence:CCGGGCGCAGTCGTAAGGAGAGCTACTCGAGTAGCTCTCCTTACGACTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003518.3-67s1c1
Sequence:CCGGGCAGAAGAAGGATGGCAAGAACTCGAGTTCTTGCCATCCTTCTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003518.3-154s1c1
Sequence:CCGGCGATACTGGCATCTCATCCAACTCGAGTTGGATGAGATGCCAGTATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003518
HIST1H2BG MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H2bg
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003518.3-352s21c1
Sequence:CCGGGGCTGTCACCAAGTATACAAGCTCGAGCTTGTATACTTGGTGACAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003518.3-40s21c1
Sequence:CCGGGGGTTCCAAGAAGGCTGTGACCTCGAGGTCACAGCCTTCTTGGAACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003518.3-199s21c1
Sequence:CCGGCGTTAACGACATCTTCGAACGCTCGAGCGTTCGAAGATGTCGTTAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003518.3-121s1c1
Sequence:CCGGGTATGTGTACAAGGTGCTAAACTCGAGTTTAGCACCTTGTACACATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003518.3-85s21c1
Sequence:CCGGGAAGCGCAAGCGCAGTCGTAACTCGAGTTACGACTGCGCTTGCGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003518.3-183s1c1
Sequence:CCGGGCATCATGAATTCCTTCGTTACTCGAGTAACGAAGGAATTCATGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003518.3-94s1c1
Sequence:CCGGGCGCAGTCGTAAGGAGAGCTACTCGAGTAGCTCTCCTTACGACTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003518.3-67s1c1
Sequence:CCGGGCAGAAGAAGGATGGCAAGAACTCGAGTTCTTGCCATCCTTCTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003518.3-154s1c1
Sequence:CCGGCGATACTGGCATCTCATCCAACTCGAGTTGGATGAGATGCCAGTATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)