EMAIL THIS PAGE TO A FRIEND

HIST1H2BH

histone cluster 1, H2bh

23 Gene Product Result for
Synonyms: H2B/j H2BFJ
UniProtKB ID: Q93079, B2R541, Q4VB74
Gene ID:
Human(8345) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a member of the histone H2B family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6. [provided by RefSeq, Jul 2008]
Mouse(319182) histone cluster 1, H2bh
Rat(306945) histone cluster 1, H2bh
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003524 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003524 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003524 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178197 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178197 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178197 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU112161 MISSION® esiRNA esiRNA human HIST1H2BH (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003524 Rosetta Predictions human pricing
NM_001107352 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003524 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023531 predicted 241
2 SASI_Hs01_00023532 predicted 78
3 SASI_Hs01_00023530 predicted 376
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107352 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227975 predicted 378
2 SASI_Rn02_00227976 predicted 632
3 SASI_Rn02_00227977 predicted 602
4 SASI_Rn02_00227978 predicted 559
5 SASI_Rn02_00227979 predicted 656
6 SASI_Rn02_00227980 predicted 611
7 SASI_Rn02_00227981 predicted 475
8 SASI_Rn02_00227982 predicted 546
9 SASI_Rn02_00227983 predicted 387
10 SASI_Rn02_00227984 predicted 635
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003524
HIST1H2BH MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H2bh
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003524.2-201s1c1
Sequence:CCGGCAACGATATCTTCGAGCGCATCTCGAGATGCGCTCGAAGATATCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003524.2-124s1c1
Sequence:CCGGGTTTACAAGGTGCTGAAGCAACTCGAGTTGCTTCAGCACCTTGTAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003524.2-111s1c1
Sequence:CCGGCTACTCCGTATACGTTTACAACTCGAGTTGTAAACGTATACGGAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003524.2-242s1c1
Sequence:CCGGTGGCTCATTACAACAAGCGTTCTCGAGAACGCTTGTTGTAATGAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003524.2-189s1c1
Sequence:CCGGGAATTCCTTTGTCAACGATATCTCGAGATATCGTTGACAAAGGAATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003524.2-360s21c1
Sequence:CCGGCAAGTACACCAGCTCCAAATACTCGAGTATTTGGAGCTGGTGTACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003524.2-74s21c1
Sequence:CCGGAGGATGGCAAGAAGCGTAAACCTCGAGGTTTACGCTTCTTGCCATCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003524
HIST1H2BH MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H2bh
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003524.2-201s1c1
Sequence:CCGGCAACGATATCTTCGAGCGCATCTCGAGATGCGCTCGAAGATATCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003524.2-124s1c1
Sequence:CCGGGTTTACAAGGTGCTGAAGCAACTCGAGTTGCTTCAGCACCTTGTAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003524.2-111s1c1
Sequence:CCGGCTACTCCGTATACGTTTACAACTCGAGTTGTAAACGTATACGGAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003524.2-242s1c1
Sequence:CCGGTGGCTCATTACAACAAGCGTTCTCGAGAACGCTTGTTGTAATGAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003524.2-189s1c1
Sequence:CCGGGAATTCCTTTGTCAACGATATCTCGAGATATCGTTGACAAAGGAATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003524.2-360s21c1
Sequence:CCGGCAAGTACACCAGCTCCAAATACTCGAGTATTTGGAGCTGGTGTACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003524.2-74s21c1
Sequence:CCGGAGGATGGCAAGAAGCGTAAACCTCGAGGTTTACGCTTCTTGCCATCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003524
HIST1H2BH MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H2bh
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003524.2-201s1c1
Sequence:CCGGCAACGATATCTTCGAGCGCATCTCGAGATGCGCTCGAAGATATCGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003524.2-124s1c1
Sequence:CCGGGTTTACAAGGTGCTGAAGCAACTCGAGTTGCTTCAGCACCTTGTAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003524.2-111s1c1
Sequence:CCGGCTACTCCGTATACGTTTACAACTCGAGTTGTAAACGTATACGGAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003524.2-242s1c1
Sequence:CCGGTGGCTCATTACAACAAGCGTTCTCGAGAACGCTTGTTGTAATGAGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003524.2-189s1c1
Sequence:CCGGGAATTCCTTTGTCAACGATATCTCGAGATATCGTTGACAAAGGAATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003524.2-360s21c1
Sequence:CCGGCAAGTACACCAGCTCCAAATACTCGAGTATTTGGAGCTGGTGTACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003524.2-74s21c1
Sequence:CCGGAGGATGGCAAGAAGCGTAAACCTCGAGGTTTACGCTTCTTGCCATCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178197
HIST1H2BH MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H2bh
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178197.1-154s1c1
Sequence:CCGGGACACCGGCATCTCCTCCAAACTCGAGTTTGGAGGAGATGCCGGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178197.1-54s1c1
Sequence:CCGGCCTGACCAAGGCCCAGAAGAACTCGAGTTCTTCTGGGCCTTGGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178197.1-42s1c1
Sequence:CCGGCTCCAAGAAGGCCCTGACCAACTCGAGTTGGTCAGGGCCTTCTTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178197.1-159s1c1
Sequence:CCGGCGGCATCTCCTCCAAAGCCATCTCGAGATGGCTTTGGAGGAGATGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178197.1-171s1c1
Sequence:CCGGCAAAGCCATGGGCATCATGAACTCGAGTTCATGATGCCCATGGCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178197
HIST1H2BH MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H2bh
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178197.1-154s1c1
Sequence:CCGGGACACCGGCATCTCCTCCAAACTCGAGTTTGGAGGAGATGCCGGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178197.1-54s1c1
Sequence:CCGGCCTGACCAAGGCCCAGAAGAACTCGAGTTCTTCTGGGCCTTGGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178197.1-42s1c1
Sequence:CCGGCTCCAAGAAGGCCCTGACCAACTCGAGTTGGTCAGGGCCTTCTTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178197.1-159s1c1
Sequence:CCGGCGGCATCTCCTCCAAAGCCATCTCGAGATGGCTTTGGAGGAGATGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178197.1-171s1c1
Sequence:CCGGCAAAGCCATGGGCATCATGAACTCGAGTTCATGATGCCCATGGCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178197
HIST1H2BH MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H2bh
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178197.1-154s1c1
Sequence:CCGGGACACCGGCATCTCCTCCAAACTCGAGTTTGGAGGAGATGCCGGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178197.1-54s1c1
Sequence:CCGGCCTGACCAAGGCCCAGAAGAACTCGAGTTCTTCTGGGCCTTGGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178197.1-42s1c1
Sequence:CCGGCTCCAAGAAGGCCCTGACCAACTCGAGTTGGTCAGGGCCTTCTTGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178197.1-159s1c1
Sequence:CCGGCGGCATCTCCTCCAAAGCCATCTCGAGATGGCTTTGGAGGAGATGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178197.1-171s1c1
Sequence:CCGGCAAAGCCATGGGCATCATGAACTCGAGTTCATGATGCCCATGGCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)