EMAIL THIS PAGE TO A FRIEND

HIST1H2BI

histone cluster 1, H2bi

10 Gene Product Result for
Synonyms: H2B/k H2BFK
Species: Human HIST1H2BI(8346)
Gene ID:
Human(8346) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a member of the histone H2B family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003525 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003525 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003525 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003525 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003525 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240202 predicted 399
2 SASI_Hs01_00240204 predicted 371
3 SASI_Hs01_00240203 predicted 397
4 SASI_Hs01_00240205 predicted 398
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003525
HIST1H2BI MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H2bi
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003525.2-159s1c1
Sequence:CCGGCGGCATCTCGTCCAAGGCTATCTCGAGATAGCCTTGGACGAGATGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003525.2-102s1c1
Sequence:CCGGCAAGGAGAGCTATTCCGTGTACTCGAGTACACGGAATAGCTCTCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003525.2-58s1c1
Sequence:CCGGACCAAGGCACAGAAGAAGGATCTCGAGATCCTTCTTCTGTGCCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003525.2-245s1c1
Sequence:CCGGCGCATTATAACAAGCGCTCGACTCGAGTCGAGCGCTTGTTATAATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003525.2-183s1c1
Sequence:CCGGGATTATGAACTCCTTCGTCAACTCGAGTTGACGAAGGAGTTCATAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003525
HIST1H2BI MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H2bi
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003525.2-159s1c1
Sequence:CCGGCGGCATCTCGTCCAAGGCTATCTCGAGATAGCCTTGGACGAGATGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003525.2-102s1c1
Sequence:CCGGCAAGGAGAGCTATTCCGTGTACTCGAGTACACGGAATAGCTCTCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003525.2-58s1c1
Sequence:CCGGACCAAGGCACAGAAGAAGGATCTCGAGATCCTTCTTCTGTGCCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003525.2-245s1c1
Sequence:CCGGCGCATTATAACAAGCGCTCGACTCGAGTCGAGCGCTTGTTATAATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003525.2-183s1c1
Sequence:CCGGGATTATGAACTCCTTCGTCAACTCGAGTTGACGAAGGAGTTCATAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003525
HIST1H2BI MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H2bi
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003525.2-159s1c1
Sequence:CCGGCGGCATCTCGTCCAAGGCTATCTCGAGATAGCCTTGGACGAGATGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003525.2-102s1c1
Sequence:CCGGCAAGGAGAGCTATTCCGTGTACTCGAGTACACGGAATAGCTCTCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003525.2-58s1c1
Sequence:CCGGACCAAGGCACAGAAGAAGGATCTCGAGATCCTTCTTCTGTGCCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003525.2-245s1c1
Sequence:CCGGCGCATTATAACAAGCGCTCGACTCGAGTCGAGCGCTTGTTATAATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003525.2-183s1c1
Sequence:CCGGGATTATGAACTCCTTCGTCAACTCGAGTTGACGAAGGAGTTCATAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)