EMAIL THIS PAGE TO A FRIEND

HIST1H2BK

histone cluster 1, H2bk

29 Gene Product Result for
Synonyms: H2B/S H2BFAiii H2BFT H2BK
UniProtKB ID: O60814, A8K7P7, Q2VPI7
Gene ID:
Human(85236) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene encodes a member of the histone H2B family. This gene is found in the histone microcluster on chromosome 6p21.33. [provided by RefSeq, Jul 2008]
Mouse(319184) histone cluster 1, H2bk
Rat(680312) histone cluster 1, H2bk
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2107589 Anti-HIST1H2BK antibody produced in rabbit affinity isolated antibody human, mouse, dog, rat, guinea pig, horse, rabbit, bovine
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080593 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080593 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080593 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175665 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175665 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175665 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080593 Rosetta Predictions human pricing
NM_001109400 Rosetta Predictions rat pricing
NM_175665 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080593 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053628 predicted 67
2 SASI_Hs01_00053629 predicted 64
3 SASI_Hs01_00053627 predicted 77
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109400 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248046 predicted 337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175665 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091614 predicted 351
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080593
VALIDATED
HIST1H2BK MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H2bk
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_080593.1-219s1c1
Sequence:CCGGCATGGGAATCATGAACTCCTTCTCGAGAAGGAGTTCATGATTCCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106710    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_080593.1-584s1c1
Sequence:CCGGCCTCTTGATCTCATTCAGATTCTCGAGAATCTGAATGAGATCAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_080593.1-144s1c1
Sequence:CCGGCAAGGAGAGCTACTCCGTATACTCGAGTATACGGAGTAGCTCTCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_080593.1-83s1c1
Sequence:CCGGGCTCGAAGAAAGCCGTGACTACTCGAGTAGTCACGGCTTTCTTCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_080593.1-234s1c1
Sequence:CCGGCTCCTTCGTCAACGACATCTTCTCGAGAAGATGTCGTTGACGAAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080593.1-496s21c1
Sequence:CCGGTTGCCTTCGGTTACCTCATTACTCGAGTAATGAGGTAACCGAAGGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421876    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080593.1-435s21c1
Sequence:CCGGAGGGACTTTCTCTGGAATTTCCTCGAGGAAATTCCAGAGAAAGTCCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080593.1-413s21c1
Sequence:CCGCGCGCTAAGTAAACTTGCCAAGCTCGAGCTTGGCAAGTTTACTTAGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433574    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080593.1-645s21c1
Sequence:CCGGTCCATTCCTTCTCTCTAATAACTCGAGTTATTAGAGAGAAGGAATGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080593
VALIDATED
HIST1H2BK MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H2bk
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_080593.1-219s1c1
Sequence:CCGGCATGGGAATCATGAACTCCTTCTCGAGAAGGAGTTCATGATTCCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106710    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_080593.1-584s1c1
Sequence:CCGGCCTCTTGATCTCATTCAGATTCTCGAGAATCTGAATGAGATCAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_080593.1-144s1c1
Sequence:CCGGCAAGGAGAGCTACTCCGTATACTCGAGTATACGGAGTAGCTCTCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_080593.1-83s1c1
Sequence:CCGGGCTCGAAGAAAGCCGTGACTACTCGAGTAGTCACGGCTTTCTTCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_080593.1-234s1c1
Sequence:CCGGCTCCTTCGTCAACGACATCTTCTCGAGAAGATGTCGTTGACGAAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080593.1-496s21c1
Sequence:CCGGTTGCCTTCGGTTACCTCATTACTCGAGTAATGAGGTAACCGAAGGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421876    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080593.1-435s21c1
Sequence:CCGGAGGGACTTTCTCTGGAATTTCCTCGAGGAAATTCCAGAGAAAGTCCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080593.1-413s21c1
Sequence:CCGCGCGCTAAGTAAACTTGCCAAGCTCGAGCTTGGCAAGTTTACTTAGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433574    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080593.1-645s21c1
Sequence:CCGGTCCATTCCTTCTCTCTAATAACTCGAGTTATTAGAGAGAAGGAATGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080593
VALIDATED
HIST1H2BK MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H2bk
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_080593.1-219s1c1
Sequence:CCGGCATGGGAATCATGAACTCCTTCTCGAGAAGGAGTTCATGATTCCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106710    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_080593.1-584s1c1
Sequence:CCGGCCTCTTGATCTCATTCAGATTCTCGAGAATCTGAATGAGATCAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_080593.1-144s1c1
Sequence:CCGGCAAGGAGAGCTACTCCGTATACTCGAGTATACGGAGTAGCTCTCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_080593.1-83s1c1
Sequence:CCGGGCTCGAAGAAAGCCGTGACTACTCGAGTAGTCACGGCTTTCTTCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_080593.1-234s1c1
Sequence:CCGGCTCCTTCGTCAACGACATCTTCTCGAGAAGATGTCGTTGACGAAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080593.1-496s21c1
Sequence:CCGGTTGCCTTCGGTTACCTCATTACTCGAGTAATGAGGTAACCGAAGGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421876    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080593.1-435s21c1
Sequence:CCGGAGGGACTTTCTCTGGAATTTCCTCGAGGAAATTCCAGAGAAAGTCCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080593.1-413s21c1
Sequence:CCGCGCGCTAAGTAAACTTGCCAAGCTCGAGCTTGGCAAGTTTACTTAGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433574    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080593.1-645s21c1
Sequence:CCGGTCCATTCCTTCTCTCTAATAACTCGAGTTATTAGAGAGAAGGAATGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175665
HIST1H2BK MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H2bk
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175665.1-66s1c1
Sequence:CCGGCCAGAAGAAGGACGGCAAGAACTCGAGTTCTTGCCGTCCTTCTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175665.1-183s1c1
Sequence:CCGGCATCATGAACTCGTTCGTGAACTCGAGTTCACGAACGAGTTCATGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175665.1-30s1c1
Sequence:CCGGCCCGAAGAAGGGCTCCAAGAACTCGAGTTCTTGGAGCCCTTCTTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175665.1-120s1c1
Sequence:CCGGGTACGTGTACAAGGTGCTGAACTCGAGTTCAGCACCTTGTACACGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175665.1-192s1c1
Sequence:CCGGCTCGTTCGTGAACGACATCTTCTCGAGAAGATGTCGTTCACGAACGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175665.1-251s21c1
Sequence:CCGGACAACAAGCGCTCGACCATCACTCGAGTGATGGTCGAGCGCTTGTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175665.1-237s21c1
Sequence:CCGGCCGCCTGGCGCATTACAACAACTCGAGTTGTTGTAATGCGCCAGGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175665.1-108s21c1
Sequence:CCGGGAGCTACTCGGTGTACGTGTACTCGAGTACACGTACACCGAGTAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175665
HIST1H2BK MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H2bk
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175665.1-66s1c1
Sequence:CCGGCCAGAAGAAGGACGGCAAGAACTCGAGTTCTTGCCGTCCTTCTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175665.1-183s1c1
Sequence:CCGGCATCATGAACTCGTTCGTGAACTCGAGTTCACGAACGAGTTCATGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175665.1-30s1c1
Sequence:CCGGCCCGAAGAAGGGCTCCAAGAACTCGAGTTCTTGGAGCCCTTCTTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175665.1-120s1c1
Sequence:CCGGGTACGTGTACAAGGTGCTGAACTCGAGTTCAGCACCTTGTACACGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175665.1-192s1c1
Sequence:CCGGCTCGTTCGTGAACGACATCTTCTCGAGAAGATGTCGTTCACGAACGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175665.1-251s21c1
Sequence:CCGGACAACAAGCGCTCGACCATCACTCGAGTGATGGTCGAGCGCTTGTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175665.1-237s21c1
Sequence:CCGGCCGCCTGGCGCATTACAACAACTCGAGTTGTTGTAATGCGCCAGGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175665.1-108s21c1
Sequence:CCGGGAGCTACTCGGTGTACGTGTACTCGAGTACACGTACACCGAGTAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175665
HIST1H2BK MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H2bk
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175665.1-66s1c1
Sequence:CCGGCCAGAAGAAGGACGGCAAGAACTCGAGTTCTTGCCGTCCTTCTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175665.1-183s1c1
Sequence:CCGGCATCATGAACTCGTTCGTGAACTCGAGTTCACGAACGAGTTCATGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175665.1-30s1c1
Sequence:CCGGCCCGAAGAAGGGCTCCAAGAACTCGAGTTCTTGGAGCCCTTCTTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175665.1-120s1c1
Sequence:CCGGGTACGTGTACAAGGTGCTGAACTCGAGTTCAGCACCTTGTACACGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175665.1-192s1c1
Sequence:CCGGCTCGTTCGTGAACGACATCTTCTCGAGAAGATGTCGTTCACGAACGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175665.1-251s21c1
Sequence:CCGGACAACAAGCGCTCGACCATCACTCGAGTGATGGTCGAGCGCTTGTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175665.1-237s21c1
Sequence:CCGGCCGCCTGGCGCATTACAACAACTCGAGTTGTTGTAATGCGCCAGGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175665.1-108s21c1
Sequence:CCGGGAGCTACTCGGTGTACGTGTACTCGAGTACACGTACACCGAGTAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)