EMAIL THIS PAGE TO A FRIEND

HIST1H2BN

histone cluster 1, H2bn

29 Gene Product Result for
Synonyms: H2B/d H2BFD
UniProtKB ID: Q99877, B2R5L4, Q494S8, Q96FB7
Gene ID:
Human(8341) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a member of the histone H2B family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the small histone gene cluster on chromosome 6p22-p21.3. [provided by RefSeq, Jul 2008]
Mouse(319187) histone cluster 1, H2bn
cow(616627) histone cluster 1, H2bk
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003520 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003520 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003520 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178201 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178201 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178201 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003520
VALIDATED
HIST1H2BN MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H2bn
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003520.3-66s21c1
Sequence:CCGGCCAGAAGAAGGACGGCAAGAACTCGAGTTCTTGCCGTCCTTCTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003520.3-250s21c1
Sequence:CCGGTACAACAAGCGCTCGACCATCCTCGAGGATGGTCGAGCGCTTGTTGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003520.3-110s21c1
Sequence:CCGGGCTACTCCGTGTACGTGTACACTCGAGTGTACACGTACACGGAGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003520.3-121s21c1
Sequence:CCGGTACGTGTACAAGGTGCTGAAGCTCGAGCTTCAGCACCTTGTACACGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003520.3-42s1c1
Sequence:CCGGCTCCAAGAAGGCAGTGACAAACTCGAGTTTGTCACTGCCTTCTTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_003520.3-30s1c1
Sequence:CCGGCCCGAAGAAAGGCTCCAAGAACTCGAGTTCTTGGAGCCTTTCTTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003520.3-183s1c1
Sequence:CCGGCATCATGAACTCCTTCGTCAACTCGAGTTGACGAAGGAGTTCATGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003520.3-54s1c1
Sequence:CCGGAGTGACAAAGGCCCAGAAGAACTCGAGTTCTTCTGGGCCTTTGTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003520.3-159s1c1
Sequence:CCGGCGGTATCTCGTCCAAGGCCATCTCGAGATGGCCTTGGACGAGATACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003520
VALIDATED
HIST1H2BN MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H2bn
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003520.3-66s21c1
Sequence:CCGGCCAGAAGAAGGACGGCAAGAACTCGAGTTCTTGCCGTCCTTCTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003520.3-250s21c1
Sequence:CCGGTACAACAAGCGCTCGACCATCCTCGAGGATGGTCGAGCGCTTGTTGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003520.3-110s21c1
Sequence:CCGGGCTACTCCGTGTACGTGTACACTCGAGTGTACACGTACACGGAGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003520.3-121s21c1
Sequence:CCGGTACGTGTACAAGGTGCTGAAGCTCGAGCTTCAGCACCTTGTACACGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003520.3-42s1c1
Sequence:CCGGCTCCAAGAAGGCAGTGACAAACTCGAGTTTGTCACTGCCTTCTTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_003520.3-30s1c1
Sequence:CCGGCCCGAAGAAAGGCTCCAAGAACTCGAGTTCTTGGAGCCTTTCTTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003520.3-183s1c1
Sequence:CCGGCATCATGAACTCCTTCGTCAACTCGAGTTGACGAAGGAGTTCATGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003520.3-54s1c1
Sequence:CCGGAGTGACAAAGGCCCAGAAGAACTCGAGTTCTTCTGGGCCTTTGTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003520.3-159s1c1
Sequence:CCGGCGGTATCTCGTCCAAGGCCATCTCGAGATGGCCTTGGACGAGATACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003520
VALIDATED
HIST1H2BN MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H2bn
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003520.3-66s21c1
Sequence:CCGGCCAGAAGAAGGACGGCAAGAACTCGAGTTCTTGCCGTCCTTCTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003520.3-250s21c1
Sequence:CCGGTACAACAAGCGCTCGACCATCCTCGAGGATGGTCGAGCGCTTGTTGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003520.3-110s21c1
Sequence:CCGGGCTACTCCGTGTACGTGTACACTCGAGTGTACACGTACACGGAGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003520.3-121s21c1
Sequence:CCGGTACGTGTACAAGGTGCTGAAGCTCGAGCTTCAGCACCTTGTACACGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003520.3-42s1c1
Sequence:CCGGCTCCAAGAAGGCAGTGACAAACTCGAGTTTGTCACTGCCTTCTTGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_003520.3-30s1c1
Sequence:CCGGCCCGAAGAAAGGCTCCAAGAACTCGAGTTCTTGGAGCCTTTCTTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003520.3-183s1c1
Sequence:CCGGCATCATGAACTCCTTCGTCAACTCGAGTTGACGAAGGAGTTCATGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003520.3-54s1c1
Sequence:CCGGAGTGACAAAGGCCCAGAAGAACTCGAGTTCTTCTGGGCCTTTGTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003520.3-159s1c1
Sequence:CCGGCGGTATCTCGTCCAAGGCCATCTCGAGATGGCCTTGGACGAGATACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178201
HIST1H2BN MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H2bn
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178201.1-84s1c1
Sequence:CCGGGAAGCGCAAGCGCAGCCGCAACTCGAGTTGCGGCTGCGCTTGCGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178201.1-171s1c1
Sequence:CCGGCAAGGCCATGGGCATCATGAACTCGAGTTCATGATGCCCATGGCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178201.1-93s1c1
Sequence:CCGGGCGCAGCCGCAAGGAGAGCTACTCGAGTAGCTCTCCTTGCGGCTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178201.1-65s1c1
Sequence:CCGGCCCAGAAGAAGGACGGCAAGACTCGAGTCTTGCCGTCCTTCTTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178201.1-42s1c1
Sequence:CCGGGTCCAAGAAGGCCGTCACCAACTCGAGTTGGTGACGGCCTTCTTGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178201
HIST1H2BN MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H2bn
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178201.1-84s1c1
Sequence:CCGGGAAGCGCAAGCGCAGCCGCAACTCGAGTTGCGGCTGCGCTTGCGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178201.1-171s1c1
Sequence:CCGGCAAGGCCATGGGCATCATGAACTCGAGTTCATGATGCCCATGGCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178201.1-93s1c1
Sequence:CCGGGCGCAGCCGCAAGGAGAGCTACTCGAGTAGCTCTCCTTGCGGCTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178201.1-65s1c1
Sequence:CCGGCCCAGAAGAAGGACGGCAAGACTCGAGTCTTGCCGTCCTTCTTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178201.1-42s1c1
Sequence:CCGGGTCCAAGAAGGCCGTCACCAACTCGAGTTGGTGACGGCCTTCTTGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178201
HIST1H2BN MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H2bn
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178201.1-84s1c1
Sequence:CCGGGAAGCGCAAGCGCAGCCGCAACTCGAGTTGCGGCTGCGCTTGCGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178201.1-171s1c1
Sequence:CCGGCAAGGCCATGGGCATCATGAACTCGAGTTCATGATGCCCATGGCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178201.1-93s1c1
Sequence:CCGGGCGCAGCCGCAAGGAGAGCTACTCGAGTAGCTCTCCTTGCGGCTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178201.1-65s1c1
Sequence:CCGGCCCAGAAGAAGGACGGCAAGACTCGAGTCTTGCCGTCCTTCTTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178201.1-42s1c1
Sequence:CCGGGTCCAAGAAGGCCGTCACCAACTCGAGTTGGTGACGGCCTTCTTGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)