EMAIL THIS PAGE TO A FRIEND

HIST1H3A

histone cluster 1, H3a

61 Gene Product Result for
Synonyms: H3/A H3FA
Gene ID:
Human(8350) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. This structure consists of approximately 146 bp of DNA wrapped around a nucleosome, an octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a member of the histone H3 family. Transcripts from this gene lack polyA tails; instead, they contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6p22-p21.3. [provided by RefSeq, Jul 2008]
Mouse(360198) histone cluster 1, H3a
Rat(679994) histone cluster 1, H3a
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
H9161 Anti-acetyl- & phospho-Histone H3 (Ac-Lys9, pSer10) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution frog, bovine, human, mouse, Caenorhabditis elegans, Drosophila, rat, chicken
immunofluorescence, microarray, western blot pricing
H9286 Anti-acetyl-Histone H3 (Ac-Lys9) antibody produced in rabbit 2-2.5 mg/mL, affinity isolated antibody, buffered aqueous solution Drosophila, human, bovine, frog, chicken, Caenorhabditis elegans, rat, mouse
immunofluorescence, microarray, western blot pricing
H0913 Anti-acetyl-Histone H3 (Ac-Lys9) antibody, Mouse monoclonal clone AH3-120, purified from hybridoma cell culture human, mouse, bovine, frog, chicken, rat, Caenorhabditis elegans, Drosophila
ELISA, immunocytochemistry, microarray, western blot pricing
D5692 Anti-dimethyl-Histone H3 (diMe-Lys4) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution Caenorhabditis elegans, Arabidopsis thaliana, Drosophila, human, bovine, frog, rat, chicken, mouse
ChIP, microarray, western blot pricing
D5567 Anti-dimethyl-Histone H3 (diMe-Lys9) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution Arabidopsis thaliana, Drosophila, Caenorhabditis elegans, bovine, human, chicken, frog, rat, mouse
ChIP, microarray, western blot pricing
SAB4500348 Anti-Histone H3 (Acetyl-Lys14) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence pricing
SAB4500349 Anti-Histone H3 (Acetyl-Lys18) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4500350 Anti-Histone H3 (Acetyl-Lys23) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunofluorescence, western blot pricing
SAB4500351 Anti-Histone H3 (Acetyl-Lys27) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry pricing
SAB4500347 Anti-Histone H3 (Acetyl-Lys9) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
H9289 Anti-Histone H3 (N-terminal) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunofluorescence, western blot pricing
H0164 Anti-Histone H3 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, plant, human, Drosophila, rat, chicken, Xenopus
immunofluorescence, western blot pricing
SAB4500352 Anti-Histone H3 antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4500353 Anti-Histone H3 antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry pricing
SAB4500354 Anti-Histone H3 antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4500355 Anti-Histone H3 antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence, western blot pricing
SAB4500356 Anti-Histone H3 antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence pricing
SAB4503282 Anti-Histone H3 antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4503283 Anti-Histone H3 antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4503284 Anti-Histone H3 antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry pricing
SAB4503285 Anti-Histone H3.1 antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
M4819 Anti-methyl-Histone H3 (Me-Lys4) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution chicken, Caenorhabditis elegans, Drosophila, bovine, mouse, human, frog, Arabidopsis thaliana, rat
western blot pricing
H7162 Anti-methyl-Histone H3 (Me-Lys9) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution Caenorhabditis elegans, mouse, rat, bovine, chicken, frog, Drosophila, human
microarray, western blot pricing
H0412 Anti-phospho-Histone H3 (pSer10) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution frog, human, mouse, Drosophila, rat, Caenorhabditis elegans, bovine, chicken
immunofluorescence, microarray, western blot pricing
SAB4503877 Anti-phospho-Histone H3 (pSer28) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4503876 Anti-phospho-Histone H3 (pThr3) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4504429 Anti-phospho-Histone H3.1 (pSer10) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB5100007 Imprint®ChIP-Validated Anti-Acetyl-Histone H3 (Ac-Lys9) (H3K9ac) antibody produced in rabbit affinity isolated antibody human
ChIP, western blot pricing
SAB5100009 Imprint ® ChiP-Validated Anti-methyl-Histone H3 (Me-Lys4) (H3K4me1) antibody produced in rabbit affinity isolated antibody chicken, frog, mouse, bovine, human
ChIP, western blot pricing
SAB5100008 Imprint® ChIP-Validated Anti-methyl-Histone H3 (Me-Lys9) (H3K9me1) affinity isolated antibody human
ChIP, western blot pricing
H0788 Monoclonal Anti-acetyl- & phospho-Histone H3 (Ac-Lys9, pSer10) antibody produced in mouse ~2 mg/mL, clone APH3-64, purified immunoglobulin, buffered aqueous solution frog, rat, Drosophila, Caenorhabditis elegans, human, mouse, bovine, chicken
ELISA, immunoprecipitation (IP), microarray, western blot pricing
SAB4200651 Monoclonal Anti-Histone H3 (C-terminal) antibody produced in mouse clone H6.10, purified from hybridoma cell culture canine, chicken, hamster, monkey, human
immunofluorescence, western blot pricing
H9908 Monoclonal Anti-phospho-Histone H3 (pSer28) antibody produced in rat ~0.5 mg/mL, clone HTA28, purified immunoglobulin, buffered aqueous solution human, bovine, hamster, mouse
flow cytometry, immunocytochemistry, microarray, western blot pricing
PLA0148 Rabbit anti-Histone H3 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human
immunohistochemistry, immunoprecipitation (IP), western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003529 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003529 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003529 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013550 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013550 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013550 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU119821 MISSION® esiRNA esiRNA human HIST1H3A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003529 Rosetta Predictions human pricing
XM_001055231 Rosetta Predictions rat pricing
NM_013550 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003529 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109035 predicted 201
2 SASI_Hs01_00109036 predicted 208
3 SASI_Hs01_00109037 predicted 199
4 SASI_Hs01_00109038 predicted 204
5 SASI_Hs01_00109039 predicted 172
6 SASI_Hs01_00109040 predicted 172
7 SASI_Hs01_00109041 predicted 305
8 SASI_Hs01_00109042 predicted 41
9 SASI_Hs01_00109043 predicted 13
10 SASI_Hs01_00109044 predicted 174
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055231 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00278886 predicted 287
2 SASI_Rn02_00278887 predicted 292
3 SASI_Rn02_00278888 predicted 281
4 SASI_Rn02_00278889 predicted 80
5 SASI_Rn02_00278890 predicted 434
6 SASI_Rn02_00278891 predicted 466
7 SASI_Rn02_00278892 predicted 83
8 SASI_Rn02_00278893 predicted 439
9 SASI_Rn02_00278894 predicted 472
10 SASI_Rn02_00278895 predicted 424
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013550 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125364 predicted 431
2 SASI_Mm01_00125365 predicted 496
3 SASI_Mm01_00125366 predicted 487
4 SASI_Mm01_00125367 predicted 464
5 SASI_Mm01_00125368 predicted 465
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003529
HIST1H3A MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H3a
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003529.2-150s21c1
Sequence:CCGGCGAGATCCGCCGTTATCAGAACTCGAGTTCTGATAACGGCGGATCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003529.2-252s21c1
Sequence:CCGGTTTCCAGAGCTCCGCTGTGATCTCGAGATCACAGCGGAGCTCTGGAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003529.2-173s1c1
Sequence:CCGGCCACTGAACTGCTTATTCGTACTCGAGTACGAATAAGCAGTTCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003529.2-182s1c1
Sequence:CCGGTGCTTATTCGTAAACTACCTTCTCGAGAAGGTAGTTTACGAATAAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003529.2-295s1c1
Sequence:CCGGGCCTACTTGGTAGGGCTATTTCTCGAGAAATAGCCCTACCAAGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003529.2-175s1c1
Sequence:CCGGACTGAACTGCTTATTCGTAAACTCGAGTTTACGAATAAGCAGTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003529.2-42s1c1
Sequence:CCGGCAAGGCGCCACGCAAACAGTTCTCGAGAACTGTTTGCGTGGCGCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003529.2-53s21c1
Sequence:CCGGGCAAACAGTTGGCCACTAAGGCTCGAGCCTTAGTGGCCAACTGTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003529.2-218s21c1
Sequence:CCGGGCGAGATTGCGCAGGACTTTACTCGAGTAAAGTCCTGCGCAATCTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003529.2-307s21c1
Sequence:CCGGGGGCTATTTGAGGACACTAACCTCGAGGTTAGTGTCCTCAAATAGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003529
HIST1H3A MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H3a
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003529.2-150s21c1
Sequence:CCGGCGAGATCCGCCGTTATCAGAACTCGAGTTCTGATAACGGCGGATCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003529.2-252s21c1
Sequence:CCGGTTTCCAGAGCTCCGCTGTGATCTCGAGATCACAGCGGAGCTCTGGAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003529.2-173s1c1
Sequence:CCGGCCACTGAACTGCTTATTCGTACTCGAGTACGAATAAGCAGTTCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003529.2-182s1c1
Sequence:CCGGTGCTTATTCGTAAACTACCTTCTCGAGAAGGTAGTTTACGAATAAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003529.2-295s1c1
Sequence:CCGGGCCTACTTGGTAGGGCTATTTCTCGAGAAATAGCCCTACCAAGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003529.2-175s1c1
Sequence:CCGGACTGAACTGCTTATTCGTAAACTCGAGTTTACGAATAAGCAGTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003529.2-42s1c1
Sequence:CCGGCAAGGCGCCACGCAAACAGTTCTCGAGAACTGTTTGCGTGGCGCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003529.2-53s21c1
Sequence:CCGGGCAAACAGTTGGCCACTAAGGCTCGAGCCTTAGTGGCCAACTGTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003529.2-218s21c1
Sequence:CCGGGCGAGATTGCGCAGGACTTTACTCGAGTAAAGTCCTGCGCAATCTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003529.2-307s21c1
Sequence:CCGGGGGCTATTTGAGGACACTAACCTCGAGGTTAGTGTCCTCAAATAGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003529
HIST1H3A MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H3a
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003529.2-150s21c1
Sequence:CCGGCGAGATCCGCCGTTATCAGAACTCGAGTTCTGATAACGGCGGATCTCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003529.2-252s21c1
Sequence:CCGGTTTCCAGAGCTCCGCTGTGATCTCGAGATCACAGCGGAGCTCTGGAAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003529.2-173s1c1
Sequence:CCGGCCACTGAACTGCTTATTCGTACTCGAGTACGAATAAGCAGTTCAGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003529.2-182s1c1
Sequence:CCGGTGCTTATTCGTAAACTACCTTCTCGAGAAGGTAGTTTACGAATAAGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003529.2-295s1c1
Sequence:CCGGGCCTACTTGGTAGGGCTATTTCTCGAGAAATAGCCCTACCAAGTAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003529.2-175s1c1
Sequence:CCGGACTGAACTGCTTATTCGTAAACTCGAGTTTACGAATAAGCAGTTCAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003529.2-42s1c1
Sequence:CCGGCAAGGCGCCACGCAAACAGTTCTCGAGAACTGTTTGCGTGGCGCCTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003529.2-53s21c1
Sequence:CCGGGCAAACAGTTGGCCACTAAGGCTCGAGCCTTAGTGGCCAACTGTTTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003529.2-218s21c1
Sequence:CCGGGCGAGATTGCGCAGGACTTTACTCGAGTAAAGTCCTGCGCAATCTCGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003529.2-307s21c1
Sequence:CCGGGGGCTATTTGAGGACACTAACCTCGAGGTTAGTGTCCTCAAATAGCCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013550
HIST1H3A MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H3a
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000092792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013550.3-250s1c1
Sequence:CCGGGCGCGAGATCGCGCAGGACTTCTCGAGAAGTCCTGCGCGATCTCGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013550.3-86s1c1
Sequence:CCGGCGCAAGCAGCTAGCCACCAAACTCGAGTTTGGTGGCTAGCTGCTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013550.3-382s1c1
Sequence:CCGGGCGTGTCACCATCATGCCCAACTCGAGTTGGGCATGATGGTGACACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013550.3-329s1c1
Sequence:CCGGGCCTACCTTGTGGGTCTGTTTCTCGAGAAACAGACCCACAAGGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013550
HIST1H3A MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H3a
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000092792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013550.3-250s1c1
Sequence:CCGGGCGCGAGATCGCGCAGGACTTCTCGAGAAGTCCTGCGCGATCTCGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013550.3-86s1c1
Sequence:CCGGCGCAAGCAGCTAGCCACCAAACTCGAGTTTGGTGGCTAGCTGCTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013550.3-382s1c1
Sequence:CCGGGCGTGTCACCATCATGCCCAACTCGAGTTGGGCATGATGGTGACACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013550.3-329s1c1
Sequence:CCGGGCCTACCTTGTGGGTCTGTTTCTCGAGAAACAGACCCACAAGGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013550
HIST1H3A MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H3a
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000092792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013550.3-250s1c1
Sequence:CCGGGCGCGAGATCGCGCAGGACTTCTCGAGAAGTCCTGCGCGATCTCGCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013550.3-86s1c1
Sequence:CCGGCGCAAGCAGCTAGCCACCAAACTCGAGTTTGGTGGCTAGCTGCTTGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013550.3-382s1c1
Sequence:CCGGGCGTGTCACCATCATGCCCAACTCGAGTTGGGCATGATGGTGACACGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013550.3-329s1c1
Sequence:CCGGGCCTACCTTGTGGGTCTGTTTCTCGAGAAACAGACCCACAAGGTAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)