EMAIL THIS PAGE TO A FRIEND

HIST1H3B

histone cluster 1, H3b

30 Gene Product Result for
Synonyms: H3/l H3FL
Gene ID:
Human(8358) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. This structure consists of approximately 146 bp of DNA wrapped around a nucleosome, an octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a member of the histone H3 family. Transcripts from this gene lack polyA tails; instead, they contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6p22-p21.3. [provided by RefSeq, Jul 2008]
Mouse(319150) histone cluster 1, H3b
Rat(314977) histone cluster 1, H3b
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
H9161 Anti-acetyl- & phospho-Histone H3 (Ac-Lys9, pSer10) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution frog, bovine, human, mouse, Caenorhabditis elegans, Drosophila, rat, chicken
immunofluorescence, microarray, western blot pricing
H9286 Anti-acetyl-Histone H3 (Ac-Lys9) antibody produced in rabbit 2-2.5 mg/mL, affinity isolated antibody, buffered aqueous solution Drosophila, human, bovine, frog, chicken, Caenorhabditis elegans, rat, mouse
immunofluorescence, microarray, western blot pricing
H0913 Anti-acetyl-Histone H3 (Ac-Lys9) antibody, Mouse monoclonal clone AH3-120, purified from hybridoma cell culture human, mouse, bovine, frog, chicken, rat, Caenorhabditis elegans, Drosophila
ELISA, immunocytochemistry, microarray, western blot pricing
D5692 Anti-dimethyl-Histone H3 (diMe-Lys4) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution Caenorhabditis elegans, Arabidopsis thaliana, Drosophila, human, bovine, frog, rat, chicken, mouse
ChIP, microarray, western blot pricing
D5567 Anti-dimethyl-Histone H3 (diMe-Lys9) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution Arabidopsis thaliana, Drosophila, Caenorhabditis elegans, bovine, human, chicken, frog, rat, mouse
ChIP, microarray, western blot pricing
H0164 Anti-Histone H3 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, plant, human, Drosophila, rat, chicken, Xenopus
immunofluorescence, western blot pricing
M4819 Anti-methyl-Histone H3 (Me-Lys4) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution chicken, Caenorhabditis elegans, Drosophila, bovine, mouse, human, frog, Arabidopsis thaliana, rat
western blot pricing
H7162 Anti-methyl-Histone H3 (Me-Lys9) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution Caenorhabditis elegans, mouse, rat, bovine, chicken, frog, Drosophila, human
microarray, western blot pricing
H0412 Anti-phospho-Histone H3 (pSer10) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution frog, human, mouse, Drosophila, rat, Caenorhabditis elegans, bovine, chicken
immunofluorescence, microarray, western blot pricing
SAB4503877 Anti-phospho-Histone H3 (pSer28) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4503876 Anti-phospho-Histone H3 (pThr3) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4504429 Anti-phospho-Histone H3.1 (pSer10) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB5100007 Imprint®ChIP-Validated Anti-Acetyl-Histone H3 (Ac-Lys9) (H3K9ac) antibody produced in rabbit affinity isolated antibody human
ChIP, western blot pricing
SAB5100009 Imprint ® ChiP-Validated Anti-methyl-Histone H3 (Me-Lys4) (H3K4me1) antibody produced in rabbit affinity isolated antibody chicken, frog, mouse, bovine, human
ChIP, western blot pricing
SAB5100008 Imprint® ChIP-Validated Anti-methyl-Histone H3 (Me-Lys9) (H3K9me1) affinity isolated antibody human
ChIP, western blot pricing
H0788 Monoclonal Anti-acetyl- & phospho-Histone H3 (Ac-Lys9, pSer10) antibody produced in mouse ~2 mg/mL, clone APH3-64, purified immunoglobulin, buffered aqueous solution frog, rat, Drosophila, Caenorhabditis elegans, human, mouse, bovine, chicken
ELISA, immunoprecipitation (IP), microarray, western blot pricing
H9908 Monoclonal Anti-phospho-Histone H3 (pSer28) antibody produced in rat ~0.5 mg/mL, clone HTA28, purified immunoglobulin, buffered aqueous solution human, bovine, hamster, mouse
flow cytometry, immunocytochemistry, microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003537 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003537 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003537 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178203 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178203 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178203 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003537 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003537 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182372 predicted 226
2 SASI_Hs01_00182373 predicted 218
3 SASI_Hs01_00182374 predicted 398
4 SASI_Hs02_00335809 predicted 388
5 SASI_Hs01_00182375 predicted 29
6 SASI_Hs01_00182377 predicted 16
7 SASI_Hs01_00182378 predicted 405
8 SASI_Hs01_00182379 predicted 400
9 SASI_Hs01_00182380 predicted 174
10 SASI_Hs01_00182381 predicted 60
11 SASI_Hs01_00182376 predicted 125
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003537
VALIDATED
HIST1H3B MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H3b
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000306761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003537.3-226s21c1
Sequence:CCGGGCCCAAGACTTCAAGACCGATCTCGAGATCGGTCTTGAAGTCTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003537.3-36s1c1
Sequence:CCGGCGGCGGTAAAGCGCCACGCAACTCGAGTTGCGTGGCGCTTTACCGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003537.3-229s1c1
Sequence:CCGGCAAGACTTCAAGACCGATCTTCTCGAGAAGATCGGTCTTGAAGTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003537.3-226s1c1
Sequence:CCGGGCCCAAGACTTCAAGACCGATCTCGAGATCGGTCTTGAAGTCTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003537.3-306s1c1
Sequence:CCGGAGGGCTCTTTGAGGACACAAACTCGAGTTTGTGTCCTCAAAGAGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003537.3-295s21c1
Sequence:CCGGGCCTACTTGGTAGGGCTCTTTCTCGAGAAAGAGCCCTACCAAGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003537.3-295s1c1
Sequence:CCGGGCCTACTTGGTAGGGCTCTTTCTCGAGAAAGAGCCCTACCAAGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003537.3-170s21c1
Sequence:CCGGAGTCGACCGAGTTGCTGATTCCTCGAGGAATCAGCAACTCGGTCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003537.3-245s21c1
Sequence:CCGGATCTTCGCTTCCAGAGCTCTGCTCGAGCAGAGCTCTGGAAGCGAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003537.3-306s21c1
Sequence:CCGGAGGGCTCTTTGAGGACACAAACTCGAGTTTGTGTCCTCAAAGAGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003537
VALIDATED
HIST1H3B MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H3b
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000306761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003537.3-226s21c1
Sequence:CCGGGCCCAAGACTTCAAGACCGATCTCGAGATCGGTCTTGAAGTCTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003537.3-36s1c1
Sequence:CCGGCGGCGGTAAAGCGCCACGCAACTCGAGTTGCGTGGCGCTTTACCGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003537.3-229s1c1
Sequence:CCGGCAAGACTTCAAGACCGATCTTCTCGAGAAGATCGGTCTTGAAGTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003537.3-226s1c1
Sequence:CCGGGCCCAAGACTTCAAGACCGATCTCGAGATCGGTCTTGAAGTCTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003537.3-306s1c1
Sequence:CCGGAGGGCTCTTTGAGGACACAAACTCGAGTTTGTGTCCTCAAAGAGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003537.3-295s21c1
Sequence:CCGGGCCTACTTGGTAGGGCTCTTTCTCGAGAAAGAGCCCTACCAAGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003537.3-295s1c1
Sequence:CCGGGCCTACTTGGTAGGGCTCTTTCTCGAGAAAGAGCCCTACCAAGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003537.3-170s21c1
Sequence:CCGGAGTCGACCGAGTTGCTGATTCCTCGAGGAATCAGCAACTCGGTCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003537.3-245s21c1
Sequence:CCGGATCTTCGCTTCCAGAGCTCTGCTCGAGCAGAGCTCTGGAAGCGAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003537.3-306s21c1
Sequence:CCGGAGGGCTCTTTGAGGACACAAACTCGAGTTTGTGTCCTCAAAGAGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003537
VALIDATED
HIST1H3B MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H3b
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000306761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003537.3-226s21c1
Sequence:CCGGGCCCAAGACTTCAAGACCGATCTCGAGATCGGTCTTGAAGTCTTGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003537.3-36s1c1
Sequence:CCGGCGGCGGTAAAGCGCCACGCAACTCGAGTTGCGTGGCGCTTTACCGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003537.3-229s1c1
Sequence:CCGGCAAGACTTCAAGACCGATCTTCTCGAGAAGATCGGTCTTGAAGTCTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003537.3-226s1c1
Sequence:CCGGGCCCAAGACTTCAAGACCGATCTCGAGATCGGTCTTGAAGTCTTGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003537.3-306s1c1
Sequence:CCGGAGGGCTCTTTGAGGACACAAACTCGAGTTTGTGTCCTCAAAGAGCCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003537.3-295s21c1
Sequence:CCGGGCCTACTTGGTAGGGCTCTTTCTCGAGAAAGAGCCCTACCAAGTAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003537.3-295s1c1
Sequence:CCGGGCCTACTTGGTAGGGCTCTTTCTCGAGAAAGAGCCCTACCAAGTAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003537.3-170s21c1
Sequence:CCGGAGTCGACCGAGTTGCTGATTCCTCGAGGAATCAGCAACTCGGTCGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003537.3-245s21c1
Sequence:CCGGATCTTCGCTTCCAGAGCTCTGCTCGAGCAGAGCTCTGGAAGCGAAGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003537.3-306s21c1
Sequence:CCGGAGGGCTCTTTGAGGACACAAACTCGAGTTTGTGTCCTCAAAGAGCCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178203
HIST1H3B MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H3b
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178203.1-187s21c1
Sequence:CCGGATCCGCAAGCTGCCGTTCCAGCTCGAGCTGGAACGGCAGCTTGCGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178203.1-233s21c1
Sequence:CCGGACTTCAAGACCGACCTGCGCTCTCGAGAGCGCAGGTCGGTCTTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178203.1-222s21c1
Sequence:CCGGGATCGCGCAGGACTTCAAGACCTCGAGGTCTTGAAGTCCTGCGCGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178203.1-107s21c1
Sequence:CCGGTGAAGAAGCCTCACCGCTACCCTCGAGGGTAGCGGTGAGGCTTCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178203.1-163s21c1
Sequence:CCGGTACCAGAAGTCGACCGAGCTGCTCGAGCAGCTCGGTCGACTTCTGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178203
HIST1H3B MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H3b
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178203.1-187s21c1
Sequence:CCGGATCCGCAAGCTGCCGTTCCAGCTCGAGCTGGAACGGCAGCTTGCGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178203.1-233s21c1
Sequence:CCGGACTTCAAGACCGACCTGCGCTCTCGAGAGCGCAGGTCGGTCTTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178203.1-222s21c1
Sequence:CCGGGATCGCGCAGGACTTCAAGACCTCGAGGTCTTGAAGTCCTGCGCGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178203.1-107s21c1
Sequence:CCGGTGAAGAAGCCTCACCGCTACCCTCGAGGGTAGCGGTGAGGCTTCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178203.1-163s21c1
Sequence:CCGGTACCAGAAGTCGACCGAGCTGCTCGAGCAGCTCGGTCGACTTCTGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178203
HIST1H3B MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H3b
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178203.1-187s21c1
Sequence:CCGGATCCGCAAGCTGCCGTTCCAGCTCGAGCTGGAACGGCAGCTTGCGGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178203.1-233s21c1
Sequence:CCGGACTTCAAGACCGACCTGCGCTCTCGAGAGCGCAGGTCGGTCTTGAAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178203.1-222s21c1
Sequence:CCGGGATCGCGCAGGACTTCAAGACCTCGAGGTCTTGAAGTCCTGCGCGATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178203.1-107s21c1
Sequence:CCGGTGAAGAAGCCTCACCGCTACCCTCGAGGGTAGCGGTGAGGCTTCTTCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178203.1-163s21c1
Sequence:CCGGTACCAGAAGTCGACCGAGCTGCTCGAGCAGCTCGGTCGACTTCTGGTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)