EMAIL THIS PAGE TO A FRIEND

HIST1H3C

histone cluster 1, H3c

37 Gene Product Result for
Synonyms: H3.1 H3/c H3FC
Gene ID:
Human(8352) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a member of the histone H3 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6. [provided by RefSeq, Jul 2008]
Mouse(319148) histone cluster 1, H3c
Rat(679950) histone cluster 1, H3c
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
H9161 Anti-acetyl- & phospho-Histone H3 (Ac-Lys9, pSer10) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution frog, bovine, human, mouse, Caenorhabditis elegans, Drosophila, rat, chicken
immunofluorescence, microarray, western blot pricing
H9286 Anti-acetyl-Histone H3 (Ac-Lys9) antibody produced in rabbit 2-2.5 mg/mL, affinity isolated antibody, buffered aqueous solution Drosophila, human, bovine, frog, chicken, Caenorhabditis elegans, rat, mouse
immunofluorescence, microarray, western blot pricing
H0913 Anti-acetyl-Histone H3 (Ac-Lys9) antibody, Mouse monoclonal clone AH3-120, purified from hybridoma cell culture human, mouse, bovine, frog, chicken, rat, Caenorhabditis elegans, Drosophila
ELISA, immunocytochemistry, microarray, western blot pricing
D5692 Anti-dimethyl-Histone H3 (diMe-Lys4) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution Caenorhabditis elegans, Arabidopsis thaliana, Drosophila, human, bovine, frog, rat, chicken, mouse
ChIP, microarray, western blot pricing
D5567 Anti-dimethyl-Histone H3 (diMe-Lys9) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution Arabidopsis thaliana, Drosophila, Caenorhabditis elegans, bovine, human, chicken, frog, rat, mouse
ChIP, microarray, western blot pricing
H0164 Anti-Histone H3 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, plant, human, Drosophila, rat, chicken, Xenopus
immunofluorescence, western blot pricing
M4819 Anti-methyl-Histone H3 (Me-Lys4) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution chicken, Caenorhabditis elegans, Drosophila, bovine, mouse, human, frog, Arabidopsis thaliana, rat
western blot pricing
H7162 Anti-methyl-Histone H3 (Me-Lys9) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution Caenorhabditis elegans, mouse, rat, bovine, chicken, frog, Drosophila, human
microarray, western blot pricing
H0412 Anti-phospho-Histone H3 (pSer10) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution frog, human, mouse, Drosophila, rat, Caenorhabditis elegans, bovine, chicken
immunofluorescence, microarray, western blot pricing
SAB4503877 Anti-phospho-Histone H3 (pSer28) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4503876 Anti-phospho-Histone H3 (pThr3) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4504429 Anti-phospho-Histone H3.1 (pSer10) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB5100007 Imprint®ChIP-Validated Anti-Acetyl-Histone H3 (Ac-Lys9) (H3K9ac) antibody produced in rabbit affinity isolated antibody human
ChIP, western blot pricing
SAB5100009 Imprint ® ChiP-Validated Anti-methyl-Histone H3 (Me-Lys4) (H3K4me1) antibody produced in rabbit affinity isolated antibody chicken, frog, mouse, bovine, human
ChIP, western blot pricing
SAB5100008 Imprint® ChIP-Validated Anti-methyl-Histone H3 (Me-Lys9) (H3K9me1) affinity isolated antibody human
ChIP, western blot pricing
H0788 Monoclonal Anti-acetyl- & phospho-Histone H3 (Ac-Lys9, pSer10) antibody produced in mouse ~2 mg/mL, clone APH3-64, purified immunoglobulin, buffered aqueous solution frog, rat, Drosophila, Caenorhabditis elegans, human, mouse, bovine, chicken
ELISA, immunoprecipitation (IP), microarray, western blot pricing
H9908 Monoclonal Anti-phospho-Histone H3 (pSer28) antibody produced in rat ~0.5 mg/mL, clone HTA28, purified immunoglobulin, buffered aqueous solution human, bovine, hamster, mouse
flow cytometry, immunocytochemistry, microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003531 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003531 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003531 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175653 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175653 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175653 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU042501 MISSION® esiRNA esiRNA human HIST1H3C (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003531 Rosetta Predictions human pricing
XM_001055051 Rosetta Predictions rat pricing
NM_175653 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003531 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046148 predicted 401
2 SASI_Hs01_00046149 predicted 339
3 SASI_Hs01_00046150 predicted 418
4 SASI_Hs01_00046151 predicted 57
5 SASI_Hs01_00046153 predicted 396
6 SASI_Hs01_00046154 predicted 305
7 SASI_Hs01_00046155 predicted 47
8 SASI_Hs01_00046156 predicted 403
9 SASI_Hs01_00046157 predicted 412
10 SASI_Hs02_00335799 predicted 320
11 SASI_Hs01_00046152 predicted 56
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055051 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00278242 predicted 434
2 SASI_Rn02_00278243 predicted 277
3 SASI_Rn02_00278244 predicted 438
4 SASI_Rn02_00278245 predicted 421
5 SASI_Rn02_00278246 predicted 440
6 SASI_Rn02_00278247 predicted 442
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175653 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084035 predicted 414
2 SASI_Mm01_00084036 predicted 412
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003531
VALIDATED
HIST1H3C MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H3c
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003531.2-302s21c1
Sequence:CCGGTGGTGGGACTCTTCGAAGACACTCGAGTGTCTTCGAAGAGTCCCACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003531.2-355s21c1
Sequence:CCGGACCATCATGCCCAAAGATATCCTCGAGGATATCTTTGGGCATGATGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_003531.2-56s1c1
Sequence:CCGGAGCAGCTTGCTACTAAAGCAGCTCGAGCTGCTTTAGTAGCAAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003531.2-101s21c1
Sequence:CCGGGTGGCGTGAAGAAACCTCATCCTCGAGGATGAGGTTTCTTCACGCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003531.2-63s1c1
Sequence:CCGGTGCTACTAAAGCAGCCCGTAACTCGAGTTACGGGCTGCTTTAGTAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_003531.2-216s1c1
Sequence:CCGGGCGAGAAATCGCCCAGGACTTCTCGAGAAGTCCTGGGCGATTTCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003531.2-143s1c1
Sequence:CCGGCCTTGCGCGAAATCCGTCGCTCTCGAGAGCGACGGATTTCGCGCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003531.2-52s1c1
Sequence:CCGGCGCAAGCAGCTTGCTACTAAACTCGAGTTTAGTAGCAAGCTGCTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003531
VALIDATED
HIST1H3C MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H3c
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003531.2-302s21c1
Sequence:CCGGTGGTGGGACTCTTCGAAGACACTCGAGTGTCTTCGAAGAGTCCCACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003531.2-355s21c1
Sequence:CCGGACCATCATGCCCAAAGATATCCTCGAGGATATCTTTGGGCATGATGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_003531.2-56s1c1
Sequence:CCGGAGCAGCTTGCTACTAAAGCAGCTCGAGCTGCTTTAGTAGCAAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000443886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003531.2-101s21c1
Sequence:CCGGGTGGCGTGAAGAAACCTCATCCTCGAGGATGAGGTTTCTTCACGCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003531.2-63s1c1
Sequence:CCGGTGCTACTAAAGCAGCCCGTAACTCGAGTTACGGGCTGCTTTAGTAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_003531.2-216s1c1
Sequence:CCGGGCGAGAAATCGCCCAGGACTTCTCGAGAAGTCCTGGGCGATTTCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003531.2-143s1c1
Sequence:CCGGCCTTGCGCGAAATCCGTCGCTCTCGAGAGCGACGGATTTCGCGCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003531.2-52s1c1
Sequence:CCGGCGCAAGCAGCTTGCTACTAAACTCGAGTTTAGTAGCAAGCTGCTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003531
VALIDATED
HIST1H3C MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H3c
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003531.2-302s21c1
Sequence:CCGGTGGTGGGACTCTTCGAAGACACTCGAGTGTCTTCGAAGAGTCCCACCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003531.2-355s21c1
Sequence:CCGGACCATCATGCCCAAAGATATCCTCGAGGATATCTTTGGGCATGATGGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_003531.2-56s1c1
Sequence:CCGGAGCAGCTTGCTACTAAAGCAGCTCGAGCTGCTTTAGTAGCAAGCTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000443886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003531.2-101s21c1
Sequence:CCGGGTGGCGTGAAGAAACCTCATCCTCGAGGATGAGGTTTCTTCACGCCACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003531.2-63s1c1
Sequence:CCGGTGCTACTAAAGCAGCCCGTAACTCGAGTTACGGGCTGCTTTAGTAGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_003531.2-216s1c1
Sequence:CCGGGCGAGAAATCGCCCAGGACTTCTCGAGAAGTCCTGGGCGATTTCTCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003531.2-143s1c1
Sequence:CCGGCCTTGCGCGAAATCCGTCGCTCTCGAGAGCGACGGATTTCGCGCAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003531.2-52s1c1
Sequence:CCGGCGCAAGCAGCTTGCTACTAAACTCGAGTTTAGTAGCAAGCTGCTTGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175653
HIST1H3C MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H3c
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175653.1-321s1c1
Sequence:CCGGCTACCTTGTGGGTCTGTTTGACTCGAGTCAAACAGACCCACAAGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175653.1-324s1c1
Sequence:CCGGCCTTGTGGGTCTGTTTGAGGACTCGAGTCCTCAAACAGACCCACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175653.1-89s1c1
Sequence:CCGGCCACCAAGGCTGCCCGCAAGACTCGAGTCTTGCGGGCAGCCTTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175653.1-315s1c1
Sequence:CCGGCGAGGCCTACCTTGTGGGTCTCTCGAGAGACCCACAAGGTAGGCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175653.1-273s1c1
Sequence:CCGGGCGCTTCCAGAGCTCGGCTGTCTCGAGACAGCCGAGCTCTGGAAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175653
HIST1H3C MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H3c
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175653.1-321s1c1
Sequence:CCGGCTACCTTGTGGGTCTGTTTGACTCGAGTCAAACAGACCCACAAGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175653.1-324s1c1
Sequence:CCGGCCTTGTGGGTCTGTTTGAGGACTCGAGTCCTCAAACAGACCCACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175653.1-89s1c1
Sequence:CCGGCCACCAAGGCTGCCCGCAAGACTCGAGTCTTGCGGGCAGCCTTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175653.1-315s1c1
Sequence:CCGGCGAGGCCTACCTTGTGGGTCTCTCGAGAGACCCACAAGGTAGGCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175653.1-273s1c1
Sequence:CCGGGCGCTTCCAGAGCTCGGCTGTCTCGAGACAGCCGAGCTCTGGAAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175653
HIST1H3C MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H3c
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175653.1-321s1c1
Sequence:CCGGCTACCTTGTGGGTCTGTTTGACTCGAGTCAAACAGACCCACAAGGTAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175653.1-324s1c1
Sequence:CCGGCCTTGTGGGTCTGTTTGAGGACTCGAGTCCTCAAACAGACCCACAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175653.1-89s1c1
Sequence:CCGGCCACCAAGGCTGCCCGCAAGACTCGAGTCTTGCGGGCAGCCTTGGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175653.1-315s1c1
Sequence:CCGGCGAGGCCTACCTTGTGGGTCTCTCGAGAGACCCACAAGGTAGGCCTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175653.1-273s1c1
Sequence:CCGGGCGCTTCCAGAGCTCGGCTGTCTCGAGACAGCCGAGCTCTGGAAGCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)