EMAIL THIS PAGE TO A FRIEND

HIST1H3D

histone cluster 1, H3d

29 Gene Product Result for
Synonyms: H3/b H3FB
Gene ID:
Human(8351) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a member of the histone H3 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6. [provided by RefSeq, Jul 2008]
Mouse(319149) histone cluster 1, H3d
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
H9161 Anti-acetyl- & phospho-Histone H3 (Ac-Lys9, pSer10) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution frog, bovine, human, mouse, Caenorhabditis elegans, Drosophila, rat, chicken
immunofluorescence, microarray, western blot pricing
H9286 Anti-acetyl-Histone H3 (Ac-Lys9) antibody produced in rabbit 2-2.5 mg/mL, affinity isolated antibody, buffered aqueous solution Drosophila, human, bovine, frog, chicken, Caenorhabditis elegans, rat, mouse
immunofluorescence, microarray, western blot pricing
H0913 Anti-acetyl-Histone H3 (Ac-Lys9) antibody, Mouse monoclonal clone AH3-120, purified from hybridoma cell culture human, mouse, bovine, frog, chicken, rat, Caenorhabditis elegans, Drosophila
ELISA, immunocytochemistry, microarray, western blot pricing
D5692 Anti-dimethyl-Histone H3 (diMe-Lys4) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution Caenorhabditis elegans, Arabidopsis thaliana, Drosophila, human, bovine, frog, rat, chicken, mouse
ChIP, microarray, western blot pricing
D5567 Anti-dimethyl-Histone H3 (diMe-Lys9) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution Arabidopsis thaliana, Drosophila, Caenorhabditis elegans, bovine, human, chicken, frog, rat, mouse
ChIP, microarray, western blot pricing
H0164 Anti-Histone H3 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, plant, human, Drosophila, rat, chicken, Xenopus
immunofluorescence, western blot pricing
M4819 Anti-methyl-Histone H3 (Me-Lys4) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution chicken, Caenorhabditis elegans, Drosophila, bovine, mouse, human, frog, Arabidopsis thaliana, rat
western blot pricing
H7162 Anti-methyl-Histone H3 (Me-Lys9) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution Caenorhabditis elegans, mouse, rat, bovine, chicken, frog, Drosophila, human
microarray, western blot pricing
SAB4300149 Anti-phospho-HIST1H3D (pSer10) antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
H0412 Anti-phospho-Histone H3 (pSer10) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution frog, human, mouse, Drosophila, rat, Caenorhabditis elegans, bovine, chicken
immunofluorescence, microarray, western blot pricing
SAB4503877 Anti-phospho-Histone H3 (pSer28) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4503876 Anti-phospho-Histone H3 (pThr3) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4504429 Anti-phospho-Histone H3.1 (pSer10) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB5100007 Imprint®ChIP-Validated Anti-Acetyl-Histone H3 (Ac-Lys9) (H3K9ac) antibody produced in rabbit affinity isolated antibody human
ChIP, western blot pricing
SAB5100009 Imprint ® ChiP-Validated Anti-methyl-Histone H3 (Me-Lys4) (H3K4me1) antibody produced in rabbit affinity isolated antibody chicken, frog, mouse, bovine, human
ChIP, western blot pricing
SAB5100008 Imprint® ChIP-Validated Anti-methyl-Histone H3 (Me-Lys9) (H3K9me1) affinity isolated antibody human
ChIP, western blot pricing
H0788 Monoclonal Anti-acetyl- & phospho-Histone H3 (Ac-Lys9, pSer10) antibody produced in mouse ~2 mg/mL, clone APH3-64, purified immunoglobulin, buffered aqueous solution frog, rat, Drosophila, Caenorhabditis elegans, human, mouse, bovine, chicken
ELISA, immunoprecipitation (IP), microarray, western blot pricing
WH0008351M1 Monoclonal Anti-HIST1H3D antibody produced in mouse clone 1D8, purified immunoglobulin, buffered aqueous solution mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
H9908 Monoclonal Anti-phospho-Histone H3 (pSer28) antibody produced in rat ~0.5 mg/mL, clone HTA28, purified immunoglobulin, buffered aqueous solution human, bovine, hamster, mouse
flow cytometry, immunocytochemistry, microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003530 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003530 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003530 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178204 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178204 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178204 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003530 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003530 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103497 predicted 456
2 SASI_Hs01_00103498 predicted 624
3 SASI_Hs01_00103499 predicted 598
4 SASI_Hs01_00103500 predicted 565
5 SASI_Hs01_00103501 predicted 453
6 SASI_Hs01_00103502 predicted 434
7 SASI_Hs01_00103503 predicted 416
8 SASI_Hs01_00103504 predicted 459
9 SASI_Hs01_00103505 predicted 409
10 SASI_Hs01_00103506 predicted 587
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003530
HIST1H3D MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H3d
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003530.3-580s1c1
Sequence:CCGGGCTGATTCGCAAACTGCCATTCTCGAGAATGGCAGTTTGCGAATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003530.3-470s1c1
Sequence:CCGGGCTGCTCGAAAGAGCGCTCCACTCGAGTGGAGCGCTCTTTCGAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003530.3-707s1c1
Sequence:CCGGCTGTTTGAGGACACCAACCTACTCGAGTAGGTTGGTGTCCTCAAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003530.3-592s1c1
Sequence:CCGGACTGCCATTCCAGCGTCTAGTCTCGAGACTAGACGCTGGAATGGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003530.3-623s1c1
Sequence:CCGGGCGCAGGACTTCAAGACTGATCTCGAGATCAGTCTTGAAGTCCTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003530.3-572s21c1
Sequence:CCGGACCGAGCTGCTGATTCGCAAACTCGAGTTTGCGAATCAGCAGCTCGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003530.3-739s21c1
Sequence:CCGGCGCCAAGCGAGTGACTATCATCTCGAGATGATAGTCACTCGCTTGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003530.3-753s21c1
Sequence:CCGGCTATCATGCCCAAGGACATCCCTCGAGGGATGTCCTTGGGCATGATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003530
HIST1H3D MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H3d
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003530.3-580s1c1
Sequence:CCGGGCTGATTCGCAAACTGCCATTCTCGAGAATGGCAGTTTGCGAATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003530.3-470s1c1
Sequence:CCGGGCTGCTCGAAAGAGCGCTCCACTCGAGTGGAGCGCTCTTTCGAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003530.3-707s1c1
Sequence:CCGGCTGTTTGAGGACACCAACCTACTCGAGTAGGTTGGTGTCCTCAAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003530.3-592s1c1
Sequence:CCGGACTGCCATTCCAGCGTCTAGTCTCGAGACTAGACGCTGGAATGGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003530.3-623s1c1
Sequence:CCGGGCGCAGGACTTCAAGACTGATCTCGAGATCAGTCTTGAAGTCCTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000447269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003530.3-572s21c1
Sequence:CCGGACCGAGCTGCTGATTCGCAAACTCGAGTTTGCGAATCAGCAGCTCGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003530.3-739s21c1
Sequence:CCGGCGCCAAGCGAGTGACTATCATCTCGAGATGATAGTCACTCGCTTGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003530.3-753s21c1
Sequence:CCGGCTATCATGCCCAAGGACATCCCTCGAGGGATGTCCTTGGGCATGATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003530
HIST1H3D MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H3d
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003530.3-580s1c1
Sequence:CCGGGCTGATTCGCAAACTGCCATTCTCGAGAATGGCAGTTTGCGAATCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003530.3-470s1c1
Sequence:CCGGGCTGCTCGAAAGAGCGCTCCACTCGAGTGGAGCGCTCTTTCGAGCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003530.3-707s1c1
Sequence:CCGGCTGTTTGAGGACACCAACCTACTCGAGTAGGTTGGTGTCCTCAAACAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003530.3-592s1c1
Sequence:CCGGACTGCCATTCCAGCGTCTAGTCTCGAGACTAGACGCTGGAATGGCAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003530.3-623s1c1
Sequence:CCGGGCGCAGGACTTCAAGACTGATCTCGAGATCAGTCTTGAAGTCCTGCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000447269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003530.3-572s21c1
Sequence:CCGGACCGAGCTGCTGATTCGCAAACTCGAGTTTGCGAATCAGCAGCTCGGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003530.3-739s21c1
Sequence:CCGGCGCCAAGCGAGTGACTATCATCTCGAGATGATAGTCACTCGCTTGGCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003530.3-753s21c1
Sequence:CCGGCTATCATGCCCAAGGACATCCCTCGAGGGATGTCCTTGGGCATGATAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178204
HIST1H3D MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H3d
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000242124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178204.1-220s21c1
Sequence:CCGGGAGATCGCGCAGGACTTCAAGCTCGAGCTTGAAGTCCTGCGCGATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178204.1-235s21c1
Sequence:CCGGTTCAAGACCGACCTGCGCTTCCTCGAGGAAGCGCAGGTCGGTCTTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178204.1-106s21c1
Sequence:CCGGGTGAAGAAGCCTCACCGCTACCTCGAGGTAGCGGTGAGGCTTCTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178204.1-167s21c1
Sequence:CCGGAGAAGTCGACCGAGCTGCTGACTCGAGTCAGCAGCTCGGTCGACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178204
HIST1H3D MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H3d
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000242124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178204.1-220s21c1
Sequence:CCGGGAGATCGCGCAGGACTTCAAGCTCGAGCTTGAAGTCCTGCGCGATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178204.1-235s21c1
Sequence:CCGGTTCAAGACCGACCTGCGCTTCCTCGAGGAAGCGCAGGTCGGTCTTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178204.1-106s21c1
Sequence:CCGGGTGAAGAAGCCTCACCGCTACCTCGAGGTAGCGGTGAGGCTTCTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178204.1-167s21c1
Sequence:CCGGAGAAGTCGACCGAGCTGCTGACTCGAGTCAGCAGCTCGGTCGACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178204
HIST1H3D MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H3d
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000242124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178204.1-220s21c1
Sequence:CCGGGAGATCGCGCAGGACTTCAAGCTCGAGCTTGAAGTCCTGCGCGATCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178204.1-235s21c1
Sequence:CCGGTTCAAGACCGACCTGCGCTTCCTCGAGGAAGCGCAGGTCGGTCTTGAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178204.1-106s21c1
Sequence:CCGGGTGAAGAAGCCTCACCGCTACCTCGAGGTAGCGGTGAGGCTTCTTCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178204.1-167s21c1
Sequence:CCGGAGAAGTCGACCGAGCTGCTGACTCGAGTCAGCAGCTCGGTCGACTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)