EMAIL THIS PAGE TO A FRIEND

HIST1H3E

histone cluster 1, H3e

32 Gene Product Result for
Synonyms: H3.1 H3/d H3FD
Gene ID:
Human(8353) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a member of the histone H3 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6. [provided by RefSeq, Jul 2008]
Mouse(319151) histone cluster 1, H3e
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
H9161 Anti-acetyl- & phospho-Histone H3 (Ac-Lys9, pSer10) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution frog, bovine, human, mouse, Caenorhabditis elegans, Drosophila, rat, chicken
immunofluorescence, microarray, western blot pricing
H9286 Anti-acetyl-Histone H3 (Ac-Lys9) antibody produced in rabbit 2-2.5 mg/mL, affinity isolated antibody, buffered aqueous solution Drosophila, human, bovine, frog, chicken, Caenorhabditis elegans, rat, mouse
immunofluorescence, microarray, western blot pricing
H0913 Anti-acetyl-Histone H3 (Ac-Lys9) antibody, Mouse monoclonal clone AH3-120, purified from hybridoma cell culture human, mouse, bovine, frog, chicken, rat, Caenorhabditis elegans, Drosophila
ELISA, immunocytochemistry, microarray, western blot pricing
D5692 Anti-dimethyl-Histone H3 (diMe-Lys4) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution Caenorhabditis elegans, Arabidopsis thaliana, Drosophila, human, bovine, frog, rat, chicken, mouse
ChIP, microarray, western blot pricing
D5567 Anti-dimethyl-Histone H3 (diMe-Lys9) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution Arabidopsis thaliana, Drosophila, Caenorhabditis elegans, bovine, human, chicken, frog, rat, mouse
ChIP, microarray, western blot pricing
H0164 Anti-Histone H3 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, plant, human, Drosophila, rat, chicken, Xenopus
immunofluorescence, western blot pricing
M4819 Anti-methyl-Histone H3 (Me-Lys4) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution chicken, Caenorhabditis elegans, Drosophila, bovine, mouse, human, frog, Arabidopsis thaliana, rat
western blot pricing
H7162 Anti-methyl-Histone H3 (Me-Lys9) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution Caenorhabditis elegans, mouse, rat, bovine, chicken, frog, Drosophila, human
microarray, western blot pricing
H0412 Anti-phospho-Histone H3 (pSer10) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution frog, human, mouse, Drosophila, rat, Caenorhabditis elegans, bovine, chicken
immunofluorescence, microarray, western blot pricing
SAB4503877 Anti-phospho-Histone H3 (pSer28) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4503876 Anti-phospho-Histone H3 (pThr3) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4504429 Anti-phospho-Histone H3.1 (pSer10) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB5100007 Imprint®ChIP-Validated Anti-Acetyl-Histone H3 (Ac-Lys9) (H3K9ac) antibody produced in rabbit affinity isolated antibody human
ChIP, western blot pricing
SAB5100009 Imprint ® ChiP-Validated Anti-methyl-Histone H3 (Me-Lys4) (H3K4me1) antibody produced in rabbit affinity isolated antibody chicken, frog, mouse, bovine, human
ChIP, western blot pricing
SAB5100008 Imprint® ChIP-Validated Anti-methyl-Histone H3 (Me-Lys9) (H3K9me1) affinity isolated antibody human
ChIP, western blot pricing
H0788 Monoclonal Anti-acetyl- & phospho-Histone H3 (Ac-Lys9, pSer10) antibody produced in mouse ~2 mg/mL, clone APH3-64, purified immunoglobulin, buffered aqueous solution frog, rat, Drosophila, Caenorhabditis elegans, human, mouse, bovine, chicken
ELISA, immunoprecipitation (IP), microarray, western blot pricing
H9908 Monoclonal Anti-phospho-Histone H3 (pSer28) antibody produced in rat ~0.5 mg/mL, clone HTA28, purified immunoglobulin, buffered aqueous solution human, bovine, hamster, mouse
flow cytometry, immunocytochemistry, microarray, western blot pricing

Small Molecule - Substrate

Product # Description Species Add to Cart
 
SRP0125 LSD1 substrate (Di-methylated K4_H3) ≥90% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003532 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003532 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003532 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178205 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178205 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178205 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU023951 MISSION® esiRNA esiRNA human HIST1H3E (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003532 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003532 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172365 predicted 167
2 SASI_Hs01_00172366 predicted 2
3 SASI_Hs01_00172367 predicted 32
4 SASI_Hs01_00172368 predicted 20
5 SASI_Hs01_00172362 predicted 416
6 SASI_Hs01_00172363 predicted 423
7 SASI_Hs01_00172369 predicted 36
8 SASI_Hs01_00172370 predicted 327
9 SASI_Hs01_00172364 predicted 343
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003532
HIST1H3E MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H3e
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003532.2-354s21c1
Sequence:CCGGGACCATCATGCCTAAAGACATCTCGAGATGTCTTTAGGCATGATGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003532.2-166s1c1
Sequence:CCGGCAGAAGTCTACCGAGCTTCTACTCGAGTAGAAGCTCGGTAGACTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003532.2-174s1c1
Sequence:CCGGTACCGAGCTTCTAATCCGGAACTCGAGTTCCGGATTAGAAGCTCGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003532.2-216s1c1
Sequence:CCGGGCGAGAAATAGCTCAGGACTTCTCGAGAAGTCCTGAGCTATTTCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003532.2-39s1c1
Sequence:CCGGCGGTAAAGCACCGCGCAAACACTCGAGTGTTTGCGCGGTGCTTTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003532.2-35s1c1
Sequence:CCGGCAGGCGGTAAAGCACCGCGCACTCGAGTGCGCGGTGCTTTACCGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003532.2-320s21c1
Sequence:CCGGACACCAACCTGTGCGCTATTCCTCGAGGAATAGCGCACAGGTTGGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003532.2-152s21c1
Sequence:CCGGAGATCCGTCGCTACCAGAAGTCTCGAGACTTCTGGTAGCGACGGATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003532.2-185s21c1
Sequence:CCGGTAATCCGGAAGCTGCCGTTTCCTCGAGGAAACGGCAGCTTCCGGATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003532
HIST1H3E MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H3e
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003532.2-354s21c1
Sequence:CCGGGACCATCATGCCTAAAGACATCTCGAGATGTCTTTAGGCATGATGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003532.2-166s1c1
Sequence:CCGGCAGAAGTCTACCGAGCTTCTACTCGAGTAGAAGCTCGGTAGACTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003532.2-174s1c1
Sequence:CCGGTACCGAGCTTCTAATCCGGAACTCGAGTTCCGGATTAGAAGCTCGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003532.2-216s1c1
Sequence:CCGGGCGAGAAATAGCTCAGGACTTCTCGAGAAGTCCTGAGCTATTTCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003532.2-39s1c1
Sequence:CCGGCGGTAAAGCACCGCGCAAACACTCGAGTGTTTGCGCGGTGCTTTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003532.2-35s1c1
Sequence:CCGGCAGGCGGTAAAGCACCGCGCACTCGAGTGCGCGGTGCTTTACCGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000443620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003532.2-320s21c1
Sequence:CCGGACACCAACCTGTGCGCTATTCCTCGAGGAATAGCGCACAGGTTGGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003532.2-152s21c1
Sequence:CCGGAGATCCGTCGCTACCAGAAGTCTCGAGACTTCTGGTAGCGACGGATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003532.2-185s21c1
Sequence:CCGGTAATCCGGAAGCTGCCGTTTCCTCGAGGAAACGGCAGCTTCCGGATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003532
HIST1H3E MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H3e
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003532.2-354s21c1
Sequence:CCGGGACCATCATGCCTAAAGACATCTCGAGATGTCTTTAGGCATGATGGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003532.2-166s1c1
Sequence:CCGGCAGAAGTCTACCGAGCTTCTACTCGAGTAGAAGCTCGGTAGACTTCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003532.2-174s1c1
Sequence:CCGGTACCGAGCTTCTAATCCGGAACTCGAGTTCCGGATTAGAAGCTCGGTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003532.2-216s1c1
Sequence:CCGGGCGAGAAATAGCTCAGGACTTCTCGAGAAGTCCTGAGCTATTTCTCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003532.2-39s1c1
Sequence:CCGGCGGTAAAGCACCGCGCAAACACTCGAGTGTTTGCGCGGTGCTTTACCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003532.2-35s1c1
Sequence:CCGGCAGGCGGTAAAGCACCGCGCACTCGAGTGCGCGGTGCTTTACCGCCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000443620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003532.2-320s21c1
Sequence:CCGGACACCAACCTGTGCGCTATTCCTCGAGGAATAGCGCACAGGTTGGTGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003532.2-152s21c1
Sequence:CCGGAGATCCGTCGCTACCAGAAGTCTCGAGACTTCTGGTAGCGACGGATCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003532.2-185s21c1
Sequence:CCGGTAATCCGGAAGCTGCCGTTTCCTCGAGGAAACGGCAGCTTCCGGATTATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178205
HIST1H3E MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H3e
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178205.1-219s1c1
Sequence:CCGGCGAGATCGCGCAGGACTTCAACTCGAGTTGAAGTCCTGCGCGATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178205.1-168s1c1
Sequence:CCGGGAAGTCGACCGAGCTGCTGATCTCGAGATCAGCAGCTCGGTCGACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178205.1-165s1c1
Sequence:CCGGCCAGAAGTCGACCGAGCTGCTCTCGAGAGCAGCTCGGTCGACTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178205.1-162s1c1
Sequence:CCGGCTACCAGAAGTCGACCGAGCTCTCGAGAGCTCGGTCGACTTCTGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178205.1-234s1c1
Sequence:CCGGCTTCAAGACCGACCTGCGCTTCTCGAGAAGCGCAGGTCGGTCTTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178205
HIST1H3E MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H3e
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178205.1-219s1c1
Sequence:CCGGCGAGATCGCGCAGGACTTCAACTCGAGTTGAAGTCCTGCGCGATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178205.1-168s1c1
Sequence:CCGGGAAGTCGACCGAGCTGCTGATCTCGAGATCAGCAGCTCGGTCGACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178205.1-165s1c1
Sequence:CCGGCCAGAAGTCGACCGAGCTGCTCTCGAGAGCAGCTCGGTCGACTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178205.1-162s1c1
Sequence:CCGGCTACCAGAAGTCGACCGAGCTCTCGAGAGCTCGGTCGACTTCTGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178205.1-234s1c1
Sequence:CCGGCTTCAAGACCGACCTGCGCTTCTCGAGAAGCGCAGGTCGGTCTTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178205
HIST1H3E MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H3e
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178205.1-219s1c1
Sequence:CCGGCGAGATCGCGCAGGACTTCAACTCGAGTTGAAGTCCTGCGCGATCTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178205.1-168s1c1
Sequence:CCGGGAAGTCGACCGAGCTGCTGATCTCGAGATCAGCAGCTCGGTCGACTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178205.1-165s1c1
Sequence:CCGGCCAGAAGTCGACCGAGCTGCTCTCGAGAGCAGCTCGGTCGACTTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178205.1-162s1c1
Sequence:CCGGCTACCAGAAGTCGACCGAGCTCTCGAGAGCTCGGTCGACTTCTGGTAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178205.1-234s1c1
Sequence:CCGGCTTCAAGACCGACCTGCGCTTCTCGAGAAGCGCAGGTCGGTCTTGAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)