EMAIL THIS PAGE TO A FRIEND

HIST1H3F

histone cluster 1, H3f

87 Gene Product Result for
Synonyms: H3/i H3FI
Gene ID:
Human(8968) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. This structure consists of approximately 146 bp of DNA wrapped around a nucleosome, an octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a member of the histone H3 family. Transcripts from this gene lack polyA tails; instead, they contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6p22-p21.3. [provided by RefSeq, Jul 2008]
Mouse(260423) histone cluster 1, H3f
Rat(364716) histone cluster 1, H3f
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
H9161 Anti-acetyl- & phospho-Histone H3 (Ac-Lys9, pSer10) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution frog, bovine, human, mouse, Caenorhabditis elegans, Drosophila, rat, chicken
immunofluorescence, microarray, western blot pricing
H9286 Anti-acetyl-Histone H3 (Ac-Lys9) antibody produced in rabbit 2-2.5 mg/mL, affinity isolated antibody, buffered aqueous solution Drosophila, human, bovine, frog, chicken, Caenorhabditis elegans, rat, mouse
immunofluorescence, microarray, western blot pricing
H0913 Anti-acetyl-Histone H3 (Ac-Lys9) antibody, Mouse monoclonal clone AH3-120, purified from hybridoma cell culture human, mouse, bovine, frog, chicken, rat, Caenorhabditis elegans, Drosophila
ELISA, immunocytochemistry, microarray, western blot pricing
D5692 Anti-dimethyl-Histone H3 (diMe-Lys4) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution Caenorhabditis elegans, Arabidopsis thaliana, Drosophila, human, bovine, frog, rat, chicken, mouse
ChIP, microarray, western blot pricing
D5567 Anti-dimethyl-Histone H3 (diMe-Lys9) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution Arabidopsis thaliana, Drosophila, Caenorhabditis elegans, bovine, human, chicken, frog, rat, mouse
ChIP, microarray, western blot pricing
H0164 Anti-Histone H3 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, plant, human, Drosophila, rat, chicken, Xenopus
immunofluorescence, western blot pricing
M4819 Anti-methyl-Histone H3 (Me-Lys4) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution chicken, Caenorhabditis elegans, Drosophila, bovine, mouse, human, frog, Arabidopsis thaliana, rat
western blot pricing
H7162 Anti-methyl-Histone H3 (Me-Lys9) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution Caenorhabditis elegans, mouse, rat, bovine, chicken, frog, Drosophila, human
microarray, western blot pricing
SAB1306180 ANTI-PHOSPHO-H3(S10) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
H0412 Anti-phospho-Histone H3 (pSer10) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution frog, human, mouse, Drosophila, rat, Caenorhabditis elegans, bovine, chicken
immunofluorescence, microarray, western blot pricing
SAB4503877 Anti-phospho-Histone H3 (pSer28) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4503876 Anti-phospho-Histone H3 (pThr3) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB5100007 Imprint®ChIP-Validated Anti-Acetyl-Histone H3 (Ac-Lys9) (H3K9ac) antibody produced in rabbit affinity isolated antibody human
ChIP, western blot pricing
SAB5100009 Imprint ® ChiP-Validated Anti-methyl-Histone H3 (Me-Lys4) (H3K4me1) antibody produced in rabbit affinity isolated antibody chicken, frog, mouse, bovine, human
ChIP, western blot pricing
SAB5100008 Imprint® ChIP-Validated Anti-methyl-Histone H3 (Me-Lys9) (H3K9me1) affinity isolated antibody human
ChIP, western blot pricing
H0788 Monoclonal Anti-acetyl- & phospho-Histone H3 (Ac-Lys9, pSer10) antibody produced in mouse ~2 mg/mL, clone APH3-64, purified immunoglobulin, buffered aqueous solution frog, rat, Drosophila, Caenorhabditis elegans, human, mouse, bovine, chicken
ELISA, immunoprecipitation (IP), microarray, western blot pricing
H9908 Monoclonal Anti-phospho-Histone H3 (pSer28) antibody produced in rat ~0.5 mg/mL, clone HTA28, purified immunoglobulin, buffered aqueous solution human, bovine, hamster, mouse
flow cytometry, immunocytochemistry, microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021018 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021018 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021018 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013548 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013548 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013548 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021018 Rosetta Predictions human pricing
XM_001071516 Rosetta Predictions rat pricing
XM_344595 Rosetta Predictions rat pricing
NM_013548 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021018 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173646 predicted 197
2 SASI_Hs01_00173647 predicted 197
3 SASI_Hs01_00173648 predicted 176
4 SASI_Hs01_00173649 predicted 168
5 SASI_Hs01_00173650 predicted 394
6 SASI_Hs01_00173651 predicted 132
7 SASI_Hs01_00173652 predicted 176
8 SASI_Hs01_00173653 predicted 165
9 SASI_Hs01_00173654 predicted 141
10 SASI_Hs01_00173655 predicted 128
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071516 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00335379 predicted 494
2 SASI_Rn02_00335380 predicted 513
3 SASI_Rn02_00335381 predicted 493
4 SASI_Rn02_00335382 predicted 491
5 SASI_Rn02_00335383 predicted 403
6 SASI_Rn02_00335384 predicted 402
7 SASI_Rn02_00335385 predicted 474
8 SASI_Rn02_00335386 predicted 502
9 SASI_Rn02_00335387 predicted 513
10 SASI_Rn02_00335388 predicted 486
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344595 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00193965 predicted 271
2 SASI_Rn01_00193966 predicted 134
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013548 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322267 predicted 910
2 SASI_Mm02_00322268 predicted 912
3 SASI_Mm01_00066077 predicted 846
4 SASI_Mm01_00066078 predicted 935
5 SASI_Mm02_00322269 predicted 909
6 SASI_Mm01_00066080 predicted 934
7 SASI_Mm02_00322270 predicted 945
8 SASI_Mm02_00322271 predicted 952
9 SASI_Mm01_00066083 predicted 936
10 SASI_Mm02_00322272 predicted 843
11 SASI_Mm01_00066079 predicted 1230
12 SASI_Mm01_00066081 predicted 1191
13 SASI_Mm01_00066082 predicted 1351
14 SASI_Mm01_00066084 predicted 1387
15 SASI_Mm01_00066085 predicted 1414
16 SASI_Mm01_00066086 predicted 1093
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021018
HIST1H3F MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H3f
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021018.2-198s1c1
Sequence:CCGGCTACCATTCCAGCGTCTGGTACTCGAGTACCAGACGCTGGAATGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021018.2-185s1c1
Sequence:CCGGACTGATTCGCAAGCTACCATTCTCGAGAATGGTAGCTTGCGAATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021018.2-179s1c1
Sequence:CCGGTGAGCTACTGATTCGCAAGCTCTCGAGAGCTTGCGAATCAGTAGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021018.2-161s1c1
Sequence:CCGGCCGCTATCAGAAATCGACTGACTCGAGTCAGTCGATTTCTGATAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021018.2-180s1c1
Sequence:CCGGGAGCTACTGATTCGCAAGCTACTCGAGTAGCTTGCGAATCAGTAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021018
HIST1H3F MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H3f
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021018.2-198s1c1
Sequence:CCGGCTACCATTCCAGCGTCTGGTACTCGAGTACCAGACGCTGGAATGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021018.2-185s1c1
Sequence:CCGGACTGATTCGCAAGCTACCATTCTCGAGAATGGTAGCTTGCGAATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021018.2-179s1c1
Sequence:CCGGTGAGCTACTGATTCGCAAGCTCTCGAGAGCTTGCGAATCAGTAGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021018.2-161s1c1
Sequence:CCGGCCGCTATCAGAAATCGACTGACTCGAGTCAGTCGATTTCTGATAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021018.2-180s1c1
Sequence:CCGGGAGCTACTGATTCGCAAGCTACTCGAGTAGCTTGCGAATCAGTAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021018
HIST1H3F MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H3f
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021018.2-198s1c1
Sequence:CCGGCTACCATTCCAGCGTCTGGTACTCGAGTACCAGACGCTGGAATGGTAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021018.2-185s1c1
Sequence:CCGGACTGATTCGCAAGCTACCATTCTCGAGAATGGTAGCTTGCGAATCAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021018.2-179s1c1
Sequence:CCGGTGAGCTACTGATTCGCAAGCTCTCGAGAGCTTGCGAATCAGTAGCTCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021018.2-161s1c1
Sequence:CCGGCCGCTATCAGAAATCGACTGACTCGAGTCAGTCGATTTCTGATAGCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021018.2-180s1c1
Sequence:CCGGGAGCTACTGATTCGCAAGCTACTCGAGTAGCTTGCGAATCAGTAGCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013548
HIST1H3F MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H3f
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174835    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013548.2-1142s1c1
Sequence:CCGGGTATGCTTTCAAACTAGAGTTCTCGAGAACTCTAGTTTGAAAGCATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013548.3-539s21c1
Sequence:CCGGGTGAAGAAACCTCACCGCTACCTCGAGGTAGCGGTGAGGTTTCTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013548.3-654s21c1
Sequence:CCGGAGATCGCGCAGGACTTCAAGACTCGAGTCTTGAAGTCCTGCGCGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013548.3-729s21c1
Sequence:CCGGCCTACCTTGTGGGTCTGTTTGCTCGAGCAAACAGACCCACAAGGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013548.3-740s21c1
Sequence:CCGGGGTCTGTTTGAGGACACCAACCTCGAGGTTGGTGTCCTCAAACAGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013548.3-788s21c1
Sequence:CCGGACCATCATGCCCAAGGACATCCTCGAGGATGTCCTTGGGCATGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013548
HIST1H3F MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H3f
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174835    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013548.2-1142s1c1
Sequence:CCGGGTATGCTTTCAAACTAGAGTTCTCGAGAACTCTAGTTTGAAAGCATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013548.3-539s21c1
Sequence:CCGGGTGAAGAAACCTCACCGCTACCTCGAGGTAGCGGTGAGGTTTCTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013548.3-654s21c1
Sequence:CCGGAGATCGCGCAGGACTTCAAGACTCGAGTCTTGAAGTCCTGCGCGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013548.3-729s21c1
Sequence:CCGGCCTACCTTGTGGGTCTGTTTGCTCGAGCAAACAGACCCACAAGGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013548.3-740s21c1
Sequence:CCGGGGTCTGTTTGAGGACACCAACCTCGAGGTTGGTGTCCTCAAACAGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013548.3-788s21c1
Sequence:CCGGACCATCATGCCCAAGGACATCCTCGAGGATGTCCTTGGGCATGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013548
HIST1H3F MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H3f
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174835    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013548.2-1142s1c1
Sequence:CCGGGTATGCTTTCAAACTAGAGTTCTCGAGAACTCTAGTTTGAAAGCATACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013548.3-539s21c1
Sequence:CCGGGTGAAGAAACCTCACCGCTACCTCGAGGTAGCGGTGAGGTTTCTTCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013548.3-654s21c1
Sequence:CCGGAGATCGCGCAGGACTTCAAGACTCGAGTCTTGAAGTCCTGCGCGATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013548.3-729s21c1
Sequence:CCGGCCTACCTTGTGGGTCTGTTTGCTCGAGCAAACAGACCCACAAGGTAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013548.3-740s21c1
Sequence:CCGGGGTCTGTTTGAGGACACCAACCTCGAGGTTGGTGTCCTCAAACAGACCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013548.3-788s21c1
Sequence:CCGGACCATCATGCCCAAGGACATCCTCGAGGATGTCCTTGGGCATGATGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)