EMAIL THIS PAGE TO A FRIEND

HIST1H3G

histone cluster 1, H3g

42 Gene Product Result for
Synonyms: H3/h H3FH
Gene ID:
Human(8355) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a member of the histone H3 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6. [provided by RefSeq, Jul 2008]
Mouse(97908) histone cluster 1, H3g
Rat(680599) histone cluster 1, H3g
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
H9161 Anti-acetyl- & phospho-Histone H3 (Ac-Lys9, pSer10) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution frog, bovine, human, mouse, Caenorhabditis elegans, Drosophila, rat, chicken
immunofluorescence, microarray, western blot pricing
H9286 Anti-acetyl-Histone H3 (Ac-Lys9) antibody produced in rabbit 2-2.5 mg/mL, affinity isolated antibody, buffered aqueous solution Drosophila, human, bovine, frog, chicken, Caenorhabditis elegans, rat, mouse
immunofluorescence, microarray, western blot pricing
H0913 Anti-acetyl-Histone H3 (Ac-Lys9) antibody, Mouse monoclonal clone AH3-120, purified from hybridoma cell culture human, mouse, bovine, frog, chicken, rat, Caenorhabditis elegans, Drosophila
ELISA, immunocytochemistry, microarray, western blot pricing
D5692 Anti-dimethyl-Histone H3 (diMe-Lys4) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution Caenorhabditis elegans, Arabidopsis thaliana, Drosophila, human, bovine, frog, rat, chicken, mouse
ChIP, microarray, western blot pricing
D5567 Anti-dimethyl-Histone H3 (diMe-Lys9) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution Arabidopsis thaliana, Drosophila, Caenorhabditis elegans, bovine, human, chicken, frog, rat, mouse
ChIP, microarray, western blot pricing
H0164 Anti-Histone H3 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, plant, human, Drosophila, rat, chicken, Xenopus
immunofluorescence, western blot pricing
M4819 Anti-methyl-Histone H3 (Me-Lys4) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution chicken, Caenorhabditis elegans, Drosophila, bovine, mouse, human, frog, Arabidopsis thaliana, rat
western blot pricing
H7162 Anti-methyl-Histone H3 (Me-Lys9) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution Caenorhabditis elegans, mouse, rat, bovine, chicken, frog, Drosophila, human
microarray, western blot pricing
H0412 Anti-phospho-Histone H3 (pSer10) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution frog, human, mouse, Drosophila, rat, Caenorhabditis elegans, bovine, chicken
immunofluorescence, microarray, western blot pricing
SAB4503877 Anti-phospho-Histone H3 (pSer28) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4503876 Anti-phospho-Histone H3 (pThr3) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4504429 Anti-phospho-Histone H3.1 (pSer10) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB5100007 Imprint®ChIP-Validated Anti-Acetyl-Histone H3 (Ac-Lys9) (H3K9ac) antibody produced in rabbit affinity isolated antibody human
ChIP, western blot pricing
SAB5100009 Imprint ® ChiP-Validated Anti-methyl-Histone H3 (Me-Lys4) (H3K4me1) antibody produced in rabbit affinity isolated antibody chicken, frog, mouse, bovine, human
ChIP, western blot pricing
SAB5100008 Imprint® ChIP-Validated Anti-methyl-Histone H3 (Me-Lys9) (H3K9me1) affinity isolated antibody human
ChIP, western blot pricing
H0788 Monoclonal Anti-acetyl- & phospho-Histone H3 (Ac-Lys9, pSer10) antibody produced in mouse ~2 mg/mL, clone APH3-64, purified immunoglobulin, buffered aqueous solution frog, rat, Drosophila, Caenorhabditis elegans, human, mouse, bovine, chicken
ELISA, immunoprecipitation (IP), microarray, western blot pricing
H9908 Monoclonal Anti-phospho-Histone H3 (pSer28) antibody produced in rat ~0.5 mg/mL, clone HTA28, purified immunoglobulin, buffered aqueous solution human, bovine, hamster, mouse
flow cytometry, immunocytochemistry, microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003534 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003534 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003534 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145073 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145073 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145073 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU094991 MISSION® esiRNA esiRNA targeting mouse Hist1h3g (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003534 Rosetta Predictions human pricing
XM_001057941 Rosetta Predictions rat pricing
NM_145073 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003534 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199350 predicted 231
2 SASI_Hs01_00199351 predicted 242
3 SASI_Hs01_00199352 predicted 413
4 SASI_Hs01_00199353 predicted 410
5 SASI_Hs01_00199354 predicted 403
6 SASI_Hs01_00199355 predicted 416
7 SASI_Hs01_00199356 predicted 401
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057941 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00288059 predicted 156
2 SASI_Rn02_00288060 predicted 155
3 SASI_Rn02_00288061 predicted 198
4 SASI_Rn02_00288062 predicted 198
5 SASI_Rn02_00288063 predicted 211
6 SASI_Rn02_00288064 predicted 216
7 SASI_Rn02_00288065 predicted 150
8 SASI_Rn02_00288066 predicted 53
9 SASI_Rn02_00288067 predicted 77
10 SASI_Rn02_00288068 predicted 231
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145073 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042503 predicted 442
2 SASI_Mm01_00042504 predicted 426
3 SASI_Mm01_00042505 predicted 452
4 SASI_Mm01_00042506 predicted 447
5 SASI_Mm01_00042507 predicted 427
6 SASI_Mm01_00042508 predicted 454
7 SASI_Mm01_00042509 predicted 431
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003534
HIST1H3G MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H3g
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003534.2-150s21c1
Sequence:CCGGCGAGATTCGCCGCTATCAGAACTCGAGTTCTGATAGCGGCGAATCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003534.2-307s21c1
Sequence:CCGGGGGCTCTTTGAGGATACCAACCTCGAGGTTGGTATCCTCAAAGAGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003534.2-195s1c1
Sequence:CCGGGTTGCCTTTCCAACGCCTGGTCTCGAGACCAGGCGTTGGAAAGGCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003534.2-226s1c1
Sequence:CCGGGCTCAGGACTTCAAGACAGATCTCGAGATCTGTCTTGAAGTCCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003534.2-216s1c1
Sequence:CCGGGCGAGAAATCGCTCAGGACTTCTCGAGAAGTCCTGAGCGATTTCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003534.2-105s1c1
Sequence:CCGGCGTGAAGAAACCTCATCGCTACTCGAGTAGCGATGAGGTTTCTTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003534.2-192s1c1
Sequence:CCGGCAAGTTGCCTTTCCAACGCCTCTCGAGAGGCGTTGGAAAGGCAACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003534
HIST1H3G MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H3g
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003534.2-150s21c1
Sequence:CCGGCGAGATTCGCCGCTATCAGAACTCGAGTTCTGATAGCGGCGAATCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003534.2-307s21c1
Sequence:CCGGGGGCTCTTTGAGGATACCAACCTCGAGGTTGGTATCCTCAAAGAGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003534.2-195s1c1
Sequence:CCGGGTTGCCTTTCCAACGCCTGGTCTCGAGACCAGGCGTTGGAAAGGCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003534.2-226s1c1
Sequence:CCGGGCTCAGGACTTCAAGACAGATCTCGAGATCTGTCTTGAAGTCCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003534.2-216s1c1
Sequence:CCGGGCGAGAAATCGCTCAGGACTTCTCGAGAAGTCCTGAGCGATTTCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003534.2-105s1c1
Sequence:CCGGCGTGAAGAAACCTCATCGCTACTCGAGTAGCGATGAGGTTTCTTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003534.2-192s1c1
Sequence:CCGGCAAGTTGCCTTTCCAACGCCTCTCGAGAGGCGTTGGAAAGGCAACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003534
HIST1H3G MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H3g
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003534.2-150s21c1
Sequence:CCGGCGAGATTCGCCGCTATCAGAACTCGAGTTCTGATAGCGGCGAATCTCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003534.2-307s21c1
Sequence:CCGGGGGCTCTTTGAGGATACCAACCTCGAGGTTGGTATCCTCAAAGAGCCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003534.2-195s1c1
Sequence:CCGGGTTGCCTTTCCAACGCCTGGTCTCGAGACCAGGCGTTGGAAAGGCAACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003534.2-226s1c1
Sequence:CCGGGCTCAGGACTTCAAGACAGATCTCGAGATCTGTCTTGAAGTCCTGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003534.2-216s1c1
Sequence:CCGGGCGAGAAATCGCTCAGGACTTCTCGAGAAGTCCTGAGCGATTTCTCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003534.2-105s1c1
Sequence:CCGGCGTGAAGAAACCTCATCGCTACTCGAGTAGCGATGAGGTTTCTTCACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003534.2-192s1c1
Sequence:CCGGCAAGTTGCCTTTCCAACGCCTCTCGAGAGGCGTTGGAAAGGCAACTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145073
VALIDATED
HIST1H3G MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H3g
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000092825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145073.1-367s1c1
Sequence:CCGGCCACGCCAAGCGTGTCACCATCTCGAGATGGTGACACGCTTGGCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145073.1-382s1c1
Sequence:CCGGCACCATCATGCCCAAGGACATCTCGAGATGTCCTTGGGCATGATGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145073.1-323s1c1
Sequence:CCGGGCCTACCTCGTGGGTCTGTTTCTCGAGAAACAGACCCACGAGGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092823    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145073.1-462s1c1
Sequence:CCGGCCACTTTAAAGGCTCTTCTTACTCGAGTAAGAAGAGCCTTTAAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145073
VALIDATED
HIST1H3G MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H3g
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000092825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145073.1-367s1c1
Sequence:CCGGCCACGCCAAGCGTGTCACCATCTCGAGATGGTGACACGCTTGGCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145073.1-382s1c1
Sequence:CCGGCACCATCATGCCCAAGGACATCTCGAGATGTCCTTGGGCATGATGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145073.1-323s1c1
Sequence:CCGGGCCTACCTCGTGGGTCTGTTTCTCGAGAAACAGACCCACGAGGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092823    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145073.1-462s1c1
Sequence:CCGGCCACTTTAAAGGCTCTTCTTACTCGAGTAAGAAGAGCCTTTAAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145073
VALIDATED
HIST1H3G MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H3g
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000092825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145073.1-367s1c1
Sequence:CCGGCCACGCCAAGCGTGTCACCATCTCGAGATGGTGACACGCTTGGCGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145073.1-382s1c1
Sequence:CCGGCACCATCATGCCCAAGGACATCTCGAGATGTCCTTGGGCATGATGGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145073.1-323s1c1
Sequence:CCGGGCCTACCTCGTGGGTCTGTTTCTCGAGAAACAGACCCACGAGGTAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092823    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145073.1-462s1c1
Sequence:CCGGCCACTTTAAAGGCTCTTCTTACTCGAGTAAGAAGAGCCTTTAAAGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)