EMAIL THIS PAGE TO A FRIEND

HIST1H3H

histone cluster 1, H3h

39 Gene Product Result for
Synonyms: H3/k H3F1K H3FK
Gene ID:
Human(8357) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a member of the histone H3 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the small histone gene cluster on chromosome 6p22-p21.3. [provided by RefSeq, Jul 2008]
Mouse(319152) histone cluster 1, H3h
Rat(680511) histone cluster 1, H3h
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
H9161 Anti-acetyl- & phospho-Histone H3 (Ac-Lys9, pSer10) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution frog, bovine, human, mouse, Caenorhabditis elegans, Drosophila, rat, chicken
immunofluorescence, microarray, western blot pricing
H9286 Anti-acetyl-Histone H3 (Ac-Lys9) antibody produced in rabbit 2-2.5 mg/mL, affinity isolated antibody, buffered aqueous solution Drosophila, human, bovine, frog, chicken, Caenorhabditis elegans, rat, mouse
immunofluorescence, microarray, western blot pricing
H0913 Anti-acetyl-Histone H3 (Ac-Lys9) antibody, Mouse monoclonal clone AH3-120, purified from hybridoma cell culture human, mouse, bovine, frog, chicken, rat, Caenorhabditis elegans, Drosophila
ELISA, immunocytochemistry, microarray, western blot pricing
D5692 Anti-dimethyl-Histone H3 (diMe-Lys4) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution Caenorhabditis elegans, Arabidopsis thaliana, Drosophila, human, bovine, frog, rat, chicken, mouse
ChIP, microarray, western blot pricing
D5567 Anti-dimethyl-Histone H3 (diMe-Lys9) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution Arabidopsis thaliana, Drosophila, Caenorhabditis elegans, bovine, human, chicken, frog, rat, mouse
ChIP, microarray, western blot pricing
H0164 Anti-Histone H3 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, plant, human, Drosophila, rat, chicken, Xenopus
immunofluorescence, western blot pricing
M4819 Anti-methyl-Histone H3 (Me-Lys4) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution chicken, Caenorhabditis elegans, Drosophila, bovine, mouse, human, frog, Arabidopsis thaliana, rat
western blot pricing
H7162 Anti-methyl-Histone H3 (Me-Lys9) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution Caenorhabditis elegans, mouse, rat, bovine, chicken, frog, Drosophila, human
microarray, western blot pricing
H0412 Anti-phospho-Histone H3 (pSer10) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution frog, human, mouse, Drosophila, rat, Caenorhabditis elegans, bovine, chicken
immunofluorescence, microarray, western blot pricing
SAB4503877 Anti-phospho-Histone H3 (pSer28) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4503876 Anti-phospho-Histone H3 (pThr3) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4504429 Anti-phospho-Histone H3.1 (pSer10) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB5100007 Imprint®ChIP-Validated Anti-Acetyl-Histone H3 (Ac-Lys9) (H3K9ac) antibody produced in rabbit affinity isolated antibody human
ChIP, western blot pricing
SAB5100009 Imprint ® ChiP-Validated Anti-methyl-Histone H3 (Me-Lys4) (H3K4me1) antibody produced in rabbit affinity isolated antibody chicken, frog, mouse, bovine, human
ChIP, western blot pricing
SAB5100008 Imprint® ChIP-Validated Anti-methyl-Histone H3 (Me-Lys9) (H3K9me1) affinity isolated antibody human
ChIP, western blot pricing
H0788 Monoclonal Anti-acetyl- & phospho-Histone H3 (Ac-Lys9, pSer10) antibody produced in mouse ~2 mg/mL, clone APH3-64, purified immunoglobulin, buffered aqueous solution frog, rat, Drosophila, Caenorhabditis elegans, human, mouse, bovine, chicken
ELISA, immunoprecipitation (IP), microarray, western blot pricing
H9908 Monoclonal Anti-phospho-Histone H3 (pSer28) antibody produced in rat ~0.5 mg/mL, clone HTA28, purified immunoglobulin, buffered aqueous solution human, bovine, hamster, mouse
flow cytometry, immunocytochemistry, microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003536 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003536 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003536 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178206 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178206 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178206 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003536 Rosetta Predictions human pricing
XM_001057500 Rosetta Predictions rat pricing
NM_178206 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003536 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335802 predicted 97
2 SASI_Hs02_00335803 predicted 100
3 SASI_Hs01_00051252 predicted 119
4 SASI_Hs02_00335804 predicted 182
5 SASI_Hs02_00335805 predicted 94
6 SASI_Hs02_00335806 predicted 92
7 SASI_Hs02_00335807 predicted 100
8 SASI_Hs02_00335808 predicted 100
9 SASI_Hs01_00051257 predicted 130
10 SASI_Hs01_00051249 predicted 421
11 SASI_Hs01_00051250 predicted 421
12 SASI_Hs01_00051251 predicted 426
13 SASI_Hs01_00051253 predicted 435
14 SASI_Hs01_00051254 predicted 414
15 SASI_Hs01_00051255 predicted 417
16 SASI_Hs01_00051256 predicted 436
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057500 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00286607 predicted 102
2 SASI_Rn02_00286608 predicted 79
3 SASI_Rn02_00286609 predicted 84
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178206 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054051 predicted 433
2 SASI_Mm01_00054052 predicted 436
3 SASI_Mm01_00054053 predicted 430
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003536
HIST1H3H MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H3h
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003536.2-128s1c1
Sequence:CCGGCATCGCTATCGGCCTGGTACACTCGAGTGTACCAGGCCGATAGCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003536.2-193s1c1
Sequence:CCGGGCTGATCAGAAAGCTGCCTTTCTCGAGAAAGGCAGCTTTCTGATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003536.2-144s1c1
Sequence:CCGGGTACAGTGGCTCTCCGCGAGACTCGAGTCTCGCGGAGAGCCACTGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003536.2-126s1c1
Sequence:CCGGCCCATCGCTATCGGCCTGGTACTCGAGTACCAGGCCGATAGCGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003536.2-238s1c1
Sequence:CCGGGCAGGACTTCAAGACCGACTTCTCGAGAAGTCGGTCTTGAAGTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003536.2-162s21c1
Sequence:CCGGAGATTCGCCGCTACCAGAAGTCTCGAGACTTCTGGTAGCGGCGAATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003536.2-383s21c1
Sequence:CCGGATCCAGCTCGCACGTCGTATCCTCGAGGATACGACGTGCGAGCTGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003536.2-351s21c1
Sequence:CCGGACGCCAAGCGGGTGACTATCACTCGAGTGATAGTCACCCGCTTGGCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003536.2-214s21c1
Sequence:CCGGTCAGCGTCTGGTGCGTGAGATCTCGAGATCTCACGCACCAGACGCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003536
HIST1H3H MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H3h
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003536.2-128s1c1
Sequence:CCGGCATCGCTATCGGCCTGGTACACTCGAGTGTACCAGGCCGATAGCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003536.2-193s1c1
Sequence:CCGGGCTGATCAGAAAGCTGCCTTTCTCGAGAAAGGCAGCTTTCTGATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003536.2-144s1c1
Sequence:CCGGGTACAGTGGCTCTCCGCGAGACTCGAGTCTCGCGGAGAGCCACTGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003536.2-126s1c1
Sequence:CCGGCCCATCGCTATCGGCCTGGTACTCGAGTACCAGGCCGATAGCGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003536.2-238s1c1
Sequence:CCGGGCAGGACTTCAAGACCGACTTCTCGAGAAGTCGGTCTTGAAGTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000447172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003536.2-162s21c1
Sequence:CCGGAGATTCGCCGCTACCAGAAGTCTCGAGACTTCTGGTAGCGGCGAATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003536.2-383s21c1
Sequence:CCGGATCCAGCTCGCACGTCGTATCCTCGAGGATACGACGTGCGAGCTGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003536.2-351s21c1
Sequence:CCGGACGCCAAGCGGGTGACTATCACTCGAGTGATAGTCACCCGCTTGGCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003536.2-214s21c1
Sequence:CCGGTCAGCGTCTGGTGCGTGAGATCTCGAGATCTCACGCACCAGACGCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003536
HIST1H3H MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H3h
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003536.2-128s1c1
Sequence:CCGGCATCGCTATCGGCCTGGTACACTCGAGTGTACCAGGCCGATAGCGATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003536.2-193s1c1
Sequence:CCGGGCTGATCAGAAAGCTGCCTTTCTCGAGAAAGGCAGCTTTCTGATCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003536.2-144s1c1
Sequence:CCGGGTACAGTGGCTCTCCGCGAGACTCGAGTCTCGCGGAGAGCCACTGTACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003536.2-126s1c1
Sequence:CCGGCCCATCGCTATCGGCCTGGTACTCGAGTACCAGGCCGATAGCGATGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003536.2-238s1c1
Sequence:CCGGGCAGGACTTCAAGACCGACTTCTCGAGAAGTCGGTCTTGAAGTCCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000447172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003536.2-162s21c1
Sequence:CCGGAGATTCGCCGCTACCAGAAGTCTCGAGACTTCTGGTAGCGGCGAATCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003536.2-383s21c1
Sequence:CCGGATCCAGCTCGCACGTCGTATCCTCGAGGATACGACGTGCGAGCTGGATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003536.2-351s21c1
Sequence:CCGGACGCCAAGCGGGTGACTATCACTCGAGTGATAGTCACCCGCTTGGCGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003536.2-214s21c1
Sequence:CCGGTCAGCGTCTGGTGCGTGAGATCTCGAGATCTCACGCACCAGACGCTGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178206
HIST1H3H MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H3h
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178206.1-228s1c1
Sequence:CCGGGCAGGACTTCAAGACCGACCTCTCGAGAGGTCGGTCTTGAAGTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178206.1-252s1c1
Sequence:CCGGCTTCCAGAGCTCGGCCGTCATCTCGAGATGACGGCCGAGCTCTGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178206.1-183s1c1
Sequence:CCGGGCTGATCCGCAAGCTGCCGTTCTCGAGAACGGCAGCTTGCGGATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178206.1-159s1c1
Sequence:CCGGGCGCTACCAGAAGTCGACCGACTCGAGTCGGTCGACTTCTGGTAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178206.1-177s1c1
Sequence:CCGGCGAGCTGCTGATCCGCAAGCTCTCGAGAGCTTGCGGATCAGCAGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178206
HIST1H3H MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H3h
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178206.1-228s1c1
Sequence:CCGGGCAGGACTTCAAGACCGACCTCTCGAGAGGTCGGTCTTGAAGTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178206.1-252s1c1
Sequence:CCGGCTTCCAGAGCTCGGCCGTCATCTCGAGATGACGGCCGAGCTCTGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178206.1-183s1c1
Sequence:CCGGGCTGATCCGCAAGCTGCCGTTCTCGAGAACGGCAGCTTGCGGATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178206.1-159s1c1
Sequence:CCGGGCGCTACCAGAAGTCGACCGACTCGAGTCGGTCGACTTCTGGTAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178206.1-177s1c1
Sequence:CCGGCGAGCTGCTGATCCGCAAGCTCTCGAGAGCTTGCGGATCAGCAGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178206
HIST1H3H MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H3h
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178206.1-228s1c1
Sequence:CCGGGCAGGACTTCAAGACCGACCTCTCGAGAGGTCGGTCTTGAAGTCCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178206.1-252s1c1
Sequence:CCGGCTTCCAGAGCTCGGCCGTCATCTCGAGATGACGGCCGAGCTCTGGAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178206.1-183s1c1
Sequence:CCGGGCTGATCCGCAAGCTGCCGTTCTCGAGAACGGCAGCTTGCGGATCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178206.1-159s1c1
Sequence:CCGGGCGCTACCAGAAGTCGACCGACTCGAGTCGGTCGACTTCTGGTAGCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178206.1-177s1c1
Sequence:CCGGCGAGCTGCTGATCCGCAAGCTCTCGAGAGCTTGCGGATCAGCAGCTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)