EMAIL THIS PAGE TO A FRIEND

HIST1H3J

histone cluster 1, H3j

29 Gene Product Result for
Synonyms: H3/j H3FJ
Species: Human HIST1H3J(8356)
Gene ID:
Human(8356) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a member of the histone H3 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the small histone gene cluster on chromosome 6p22-p21.3. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
H9161 Anti-acetyl- & phospho-Histone H3 (Ac-Lys9, pSer10) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution frog, bovine, human, mouse, Caenorhabditis elegans, Drosophila, rat, chicken
immunofluorescence, microarray, western blot pricing
H9286 Anti-acetyl-Histone H3 (Ac-Lys9) antibody produced in rabbit 2-2.5 mg/mL, affinity isolated antibody, buffered aqueous solution Drosophila, human, bovine, frog, chicken, Caenorhabditis elegans, rat, mouse
immunofluorescence, microarray, western blot pricing
H0913 Anti-acetyl-Histone H3 (Ac-Lys9) antibody, Mouse monoclonal clone AH3-120, purified from hybridoma cell culture human, mouse, bovine, frog, chicken, rat, Caenorhabditis elegans, Drosophila
ELISA, immunocytochemistry, microarray, western blot pricing
D5692 Anti-dimethyl-Histone H3 (diMe-Lys4) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution Caenorhabditis elegans, Arabidopsis thaliana, Drosophila, human, bovine, frog, rat, chicken, mouse
ChIP, microarray, western blot pricing
D5567 Anti-dimethyl-Histone H3 (diMe-Lys9) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution Arabidopsis thaliana, Drosophila, Caenorhabditis elegans, bovine, human, chicken, frog, rat, mouse
ChIP, microarray, western blot pricing
H0164 Anti-Histone H3 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, plant, human, Drosophila, rat, chicken, Xenopus
immunofluorescence, western blot pricing
M4819 Anti-methyl-Histone H3 (Me-Lys4) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution chicken, Caenorhabditis elegans, Drosophila, bovine, mouse, human, frog, Arabidopsis thaliana, rat
western blot pricing
H7162 Anti-methyl-Histone H3 (Me-Lys9) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution Caenorhabditis elegans, mouse, rat, bovine, chicken, frog, Drosophila, human
microarray, western blot pricing
H0412 Anti-phospho-Histone H3 (pSer10) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution frog, human, mouse, Drosophila, rat, Caenorhabditis elegans, bovine, chicken
immunofluorescence, microarray, western blot pricing
SAB4503877 Anti-phospho-Histone H3 (pSer28) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4503876 Anti-phospho-Histone H3 (pThr3) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4504429 Anti-phospho-Histone H3.1 (pSer10) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB5100007 Imprint®ChIP-Validated Anti-Acetyl-Histone H3 (Ac-Lys9) (H3K9ac) antibody produced in rabbit affinity isolated antibody human
ChIP, western blot pricing
SAB5100009 Imprint ® ChiP-Validated Anti-methyl-Histone H3 (Me-Lys4) (H3K4me1) antibody produced in rabbit affinity isolated antibody chicken, frog, mouse, bovine, human
ChIP, western blot pricing
SAB5100008 Imprint® ChIP-Validated Anti-methyl-Histone H3 (Me-Lys9) (H3K9me1) affinity isolated antibody human
ChIP, western blot pricing
H0788 Monoclonal Anti-acetyl- & phospho-Histone H3 (Ac-Lys9, pSer10) antibody produced in mouse ~2 mg/mL, clone APH3-64, purified immunoglobulin, buffered aqueous solution frog, rat, Drosophila, Caenorhabditis elegans, human, mouse, bovine, chicken
ELISA, immunoprecipitation (IP), microarray, western blot pricing
H9908 Monoclonal Anti-phospho-Histone H3 (pSer28) antibody produced in rat ~0.5 mg/mL, clone HTA28, purified immunoglobulin, buffered aqueous solution human, bovine, hamster, mouse
flow cytometry, immunocytochemistry, microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003535 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003535 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003535 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003535 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003535 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211006 predicted 210
2 SASI_Hs01_00211007 predicted 215
3 SASI_Hs01_00211008 predicted 212
4 SASI_Hs01_00211010 predicted 288
5 SASI_Hs01_00211011 predicted 290
6 SASI_Hs01_00211013 predicted 287
7 SASI_Hs01_00211015 predicted 362
8 SASI_Hs02_00335800 predicted 322
9 SASI_Hs02_00335801 predicted 326
10 SASI_Hs01_00211009 predicted 409
11 SASI_Hs01_00211012 predicted 414
12 SASI_Hs01_00211014 predicted 422
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003535
VALIDATED
HIST1H3J MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H3j
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003535.2-186s1c1
Sequence:CCGGCATCCGCAAACTGCCATTTCACTCGAGTGAAATGGCAGTTTGCGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003535.2-143s1c1
Sequence:CCGGCCTTGCGTGAGATCCGCCGTTCTCGAGAACGGCGGATCTCACGCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003535.2-177s1c1
Sequence:CCGGTGAGCTGCTCATCCGCAAACTCTCGAGAGTTTGCGGATGAGCAGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003535.2-90s1c1
Sequence:CCGGTCCAGCGACTGGCGGTGTGAACTCGAGTTCACACCGCCAGTCGCTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003535.2-319s1c1
Sequence:CCGGGACACCAACCTCTGTGCTATTCTCGAGAATAGCACAGAGGTTGGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003535.2-215s21c1
Sequence:CCGGTGCGAGAAATCGCGCAGGATTCTCGAGAATCCTGCGCGATTTCTCGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003535.2-160s21c1
Sequence:CCGGCGTTATCAGAAGTCGACTGAGCTCGAGCTCAGTCGACTTCTGATAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003535.2-296s21c1
Sequence:CCGGCCTATCTGGTGGGTCTCTTTGCTCGAGCAAAGAGACCCACCAGATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003535
VALIDATED
HIST1H3J MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H3j
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003535.2-186s1c1
Sequence:CCGGCATCCGCAAACTGCCATTTCACTCGAGTGAAATGGCAGTTTGCGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003535.2-143s1c1
Sequence:CCGGCCTTGCGTGAGATCCGCCGTTCTCGAGAACGGCGGATCTCACGCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003535.2-177s1c1
Sequence:CCGGTGAGCTGCTCATCCGCAAACTCTCGAGAGTTTGCGGATGAGCAGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003535.2-90s1c1
Sequence:CCGGTCCAGCGACTGGCGGTGTGAACTCGAGTTCACACCGCCAGTCGCTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003535.2-319s1c1
Sequence:CCGGGACACCAACCTCTGTGCTATTCTCGAGAATAGCACAGAGGTTGGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003535.2-215s21c1
Sequence:CCGGTGCGAGAAATCGCGCAGGATTCTCGAGAATCCTGCGCGATTTCTCGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003535.2-160s21c1
Sequence:CCGGCGTTATCAGAAGTCGACTGAGCTCGAGCTCAGTCGACTTCTGATAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003535.2-296s21c1
Sequence:CCGGCCTATCTGGTGGGTCTCTTTGCTCGAGCAAAGAGACCCACCAGATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003535
VALIDATED
HIST1H3J MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H3j
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003535.2-186s1c1
Sequence:CCGGCATCCGCAAACTGCCATTTCACTCGAGTGAAATGGCAGTTTGCGGATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003535.2-143s1c1
Sequence:CCGGCCTTGCGTGAGATCCGCCGTTCTCGAGAACGGCGGATCTCACGCAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003535.2-177s1c1
Sequence:CCGGTGAGCTGCTCATCCGCAAACTCTCGAGAGTTTGCGGATGAGCAGCTCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003535.2-90s1c1
Sequence:CCGGTCCAGCGACTGGCGGTGTGAACTCGAGTTCACACCGCCAGTCGCTGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003535.2-319s1c1
Sequence:CCGGGACACCAACCTCTGTGCTATTCTCGAGAATAGCACAGAGGTTGGTGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003535.2-215s21c1
Sequence:CCGGTGCGAGAAATCGCGCAGGATTCTCGAGAATCCTGCGCGATTTCTCGCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003535.2-160s21c1
Sequence:CCGGCGTTATCAGAAGTCGACTGAGCTCGAGCTCAGTCGACTTCTGATAACGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003535.2-296s21c1
Sequence:CCGGCCTATCTGGTGGGTCTCTTTGCTCGAGCAAAGAGACCCACCAGATAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)