EMAIL THIS PAGE TO A FRIEND

HIST1H4F

histone cluster 1, H4f

12 Gene Product Result for
Synonyms: H4 H4/c H4FC
Gene ID:
Human(8361) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a member of the histone H4 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6. [provided by RefSeq, Jul 2008]
Mouse(319157) histone cluster 1, H4f
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175655 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175655 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175655 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003540 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003540 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003540 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU173681 MISSION® esiRNA esiRNA targeting mouse Hist1h4f mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003540 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003540 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180802 predicted 13
2 SASI_Hs01_00180803 predicted 52
3 SASI_Hs02_00335811 predicted 288
4 SASI_Hs01_00180804 predicted 14
5 SASI_Hs01_00180805 predicted 235
6 SASI_Hs01_00180806 predicted 130
7 SASI_Hs01_00180807 predicted 128
8 SASI_Hs01_00180808 predicted 58
9 SASI_Hs01_00180809 predicted 160
10 SASI_Hs01_00180810 predicted 236
11 SASI_Hs01_00180811 predicted 247
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175655
HIST1H4F MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H4f
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175655.1-142s1c1
Sequence:CCGGTCCGGTCTCATCTACGAGGAACTCGAGTTCCTCGTAGATGAGACCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175655.1-57s1c1
Sequence:CCGGCCGTAAGGTTCTTCGCGATAACTCGAGTTATCGCGAAGAACCTTACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175655.1-143s1c1
Sequence:CCGGCCGGTCTCATCTACGAGGAAACTCGAGTTTCCTCGTAGATGAGACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175655.1-56s1c1
Sequence:CCGGACCGTAAGGTTCTTCGCGATACTCGAGTATCGCGAAGAACCTTACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175655.1-132s1c1
Sequence:CCGGGAAGCGCATCTCCGGTCTCATCTCGAGATGAGACCGGAGATGCGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175655
HIST1H4F MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H4f
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175655.1-142s1c1
Sequence:CCGGTCCGGTCTCATCTACGAGGAACTCGAGTTCCTCGTAGATGAGACCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175655.1-57s1c1
Sequence:CCGGCCGTAAGGTTCTTCGCGATAACTCGAGTTATCGCGAAGAACCTTACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175655.1-143s1c1
Sequence:CCGGCCGGTCTCATCTACGAGGAAACTCGAGTTTCCTCGTAGATGAGACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175655.1-56s1c1
Sequence:CCGGACCGTAAGGTTCTTCGCGATACTCGAGTATCGCGAAGAACCTTACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175655.1-132s1c1
Sequence:CCGGGAAGCGCATCTCCGGTCTCATCTCGAGATGAGACCGGAGATGCGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175655
HIST1H4F MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H4f
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175655.1-142s1c1
Sequence:CCGGTCCGGTCTCATCTACGAGGAACTCGAGTTCCTCGTAGATGAGACCGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175655.1-57s1c1
Sequence:CCGGCCGTAAGGTTCTTCGCGATAACTCGAGTTATCGCGAAGAACCTTACGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175655.1-143s1c1
Sequence:CCGGCCGGTCTCATCTACGAGGAAACTCGAGTTTCCTCGTAGATGAGACCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175655.1-56s1c1
Sequence:CCGGACCGTAAGGTTCTTCGCGATACTCGAGTATCGCGAAGAACCTTACGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175655.1-132s1c1
Sequence:CCGGGAAGCGCATCTCCGGTCTCATCTCGAGATGAGACCGGAGATGCGCTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003540
HIST1H4F MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H4f
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003540.3-135s1c1
Sequence:CCGGACGCATTTCGGGCCTCATTTACTCGAGTAAATGAGGCCCGAAATGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003540.3-175s1c1
Sequence:CCGGCTTAAGGTGTTCCTGGAGAATCTCGAGATTCTCCAGGAACACCTTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003540.3-181s1c1
Sequence:CCGGGTGTTCCTGGAGAATGTGATACTCGAGTATCACATTCTCCAGGAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003540.3-54s1c1
Sequence:CCGGCCATCGCAAAGTGCTGCGTGACTCGAGTCACGCAGCACTTTGCGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003540.3-63s1c1
Sequence:CCGGAGTGCTGCGTGACAACATACACTCGAGTGTATGTTGTCACGCAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003540
HIST1H4F MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H4f
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003540.3-135s1c1
Sequence:CCGGACGCATTTCGGGCCTCATTTACTCGAGTAAATGAGGCCCGAAATGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003540.3-175s1c1
Sequence:CCGGCTTAAGGTGTTCCTGGAGAATCTCGAGATTCTCCAGGAACACCTTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003540.3-181s1c1
Sequence:CCGGGTGTTCCTGGAGAATGTGATACTCGAGTATCACATTCTCCAGGAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003540.3-54s1c1
Sequence:CCGGCCATCGCAAAGTGCTGCGTGACTCGAGTCACGCAGCACTTTGCGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003540.3-63s1c1
Sequence:CCGGAGTGCTGCGTGACAACATACACTCGAGTGTATGTTGTCACGCAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003540
HIST1H4F MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H4f
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003540.3-135s1c1
Sequence:CCGGACGCATTTCGGGCCTCATTTACTCGAGTAAATGAGGCCCGAAATGCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003540.3-175s1c1
Sequence:CCGGCTTAAGGTGTTCCTGGAGAATCTCGAGATTCTCCAGGAACACCTTAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003540.3-181s1c1
Sequence:CCGGGTGTTCCTGGAGAATGTGATACTCGAGTATCACATTCTCCAGGAACACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003540.3-54s1c1
Sequence:CCGGCCATCGCAAAGTGCTGCGTGACTCGAGTCACGCAGCACTTTGCGATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003540.3-63s1c1
Sequence:CCGGAGTGCTGCGTGACAACATACACTCGAGTGTATGTTGTCACGCAGCACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)