EMAIL THIS PAGE TO A FRIEND

HIST1H4G

histone cluster 1, H4g

16 Gene Product Result for
Synonyms: H4/l H4FL
Species: Human HIST1H4G(8369)
UniProtKB ID: Q99525
Gene ID:
Human(8369) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a member of the histone H4 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301738 ANTI-H4G (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003547 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003547 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003547 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003547 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003547 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111388 predicted 75
2 SASI_Hs01_00111389 predicted 286
3 SASI_Hs01_00111390 predicted 313
4 SASI_Hs02_00335820 predicted 56
5 SASI_Hs01_00111391 predicted 58
6 SASI_Hs01_00111392 predicted 135
7 SASI_Hs01_00111393 predicted 70
8 SASI_Hs01_00111394 predicted 289
9 SASI_Hs01_00111395 predicted 43
10 SASI_Hs01_00111396 predicted 82
11 SASI_Hs01_00111397 predicted 138
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003547
HIST1H4G MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H4g
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003547.2-123s1c1
Sequence:CCGGTGGCGGTGTCAAGCGCATCTTCTCGAGAAGATGCGCTTGACACCGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003547.2-71s1c1
Sequence:CCGGGCGATAATATTCAGGGCATTACTCGAGTAATGCCCTGAATATTATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003547.2-58s1c1
Sequence:CCGGCGCAAGGTACTGAGCGATAATCTCGAGATTATCGCTCAGTACCTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003547.2-42s1c1
Sequence:CCGGCGGTGCCAAGTGCCATCGCAACTCGAGTTGCGATGGCACTTGGCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003547.2-198s1c1
Sequence:CCGGGATCTGGTACGCCGTGACCAACTCGAGTTGGTCACGGCGTACCAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003547.2-50s21c1
Sequence:CCGGAGTGCCATCGCAAGGTACTGACTCGAGTCAGTACCTTGCGATGGCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003547.2-270s21c1
Sequence:CCGGGCTCAAACGCCAGGGAAGAACCTCGAGGTTCTTCCCTGGCGTTTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003547
HIST1H4G MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H4g
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003547.2-123s1c1
Sequence:CCGGTGGCGGTGTCAAGCGCATCTTCTCGAGAAGATGCGCTTGACACCGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003547.2-71s1c1
Sequence:CCGGGCGATAATATTCAGGGCATTACTCGAGTAATGCCCTGAATATTATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003547.2-58s1c1
Sequence:CCGGCGCAAGGTACTGAGCGATAATCTCGAGATTATCGCTCAGTACCTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003547.2-42s1c1
Sequence:CCGGCGGTGCCAAGTGCCATCGCAACTCGAGTTGCGATGGCACTTGGCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003547.2-198s1c1
Sequence:CCGGGATCTGGTACGCCGTGACCAACTCGAGTTGGTCACGGCGTACCAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003547.2-50s21c1
Sequence:CCGGAGTGCCATCGCAAGGTACTGACTCGAGTCAGTACCTTGCGATGGCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003547.2-270s21c1
Sequence:CCGGGCTCAAACGCCAGGGAAGAACCTCGAGGTTCTTCCCTGGCGTTTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003547
HIST1H4G MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H4g
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003547.2-123s1c1
Sequence:CCGGTGGCGGTGTCAAGCGCATCTTCTCGAGAAGATGCGCTTGACACCGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003547.2-71s1c1
Sequence:CCGGGCGATAATATTCAGGGCATTACTCGAGTAATGCCCTGAATATTATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003547.2-58s1c1
Sequence:CCGGCGCAAGGTACTGAGCGATAATCTCGAGATTATCGCTCAGTACCTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003547.2-42s1c1
Sequence:CCGGCGGTGCCAAGTGCCATCGCAACTCGAGTTGCGATGGCACTTGGCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003547.2-198s1c1
Sequence:CCGGGATCTGGTACGCCGTGACCAACTCGAGTTGGTCACGGCGTACCAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003547.2-50s21c1
Sequence:CCGGAGTGCCATCGCAAGGTACTGACTCGAGTCAGTACCTTGCGATGGCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003547.2-270s21c1
Sequence:CCGGGCTCAAACGCCAGGGAAGAACCTCGAGGTTCTTCCCTGGCGTTTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)