EMAIL THIS PAGE TO A FRIEND

HIST1H4H

histone cluster 1, H4h

18 Gene Product Result for
Synonyms: H4/h H4FH
Gene ID:
Human(8365) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a member of the histone H4 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6. [provided by RefSeq, Jul 2008]
Mouse(69386) histone cluster 1, H4h
Rat(306955) histone cluster 1, H4h
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003543 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003543 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003543 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153173 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153173 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153173 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU138451 MISSION® esiRNA esiRNA human HIST1H4H (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003543 Rosetta Predictions human pricing
NM_153173 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003543 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235156 predicted 229
2 SASI_Hs01_00235157 predicted 232
3 SASI_Hs01_00235158 predicted 134
4 SASI_Hs01_00235159 predicted 34
5 SASI_Hs01_00235160 predicted 314
6 SASI_Hs01_00235161 predicted 157
7 SASI_Hs01_00235162 predicted 316
8 SASI_Hs01_00235163 predicted 128
9 SASI_Hs01_00235164 predicted 88
10 SASI_Hs01_00235165 predicted 127
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153173 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064631 predicted 357
2 SASI_Mm01_00064632 predicted 81
3 SASI_Mm01_00064633 predicted 371
4 SASI_Mm01_00064634 predicted 361
5 SASI_Mm01_00064635 predicted 74
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003543
VALIDATED
HIST1H4H MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H4h
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003543.3-132s1c1
Sequence:CCGGCAAGCGAATTTCTGGCCTTATCTCGAGATAAGGCCAGAAATTCGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003543.3-41s1c1
Sequence:CCGGGAGGAGCTAAGCGTCATCGCACTCGAGTGCGATGACGCTTAGCTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003543.3-202s1c1
Sequence:CCGGCGTGACGCTGTCACTTACACACTCGAGTGTGTAAGTGACAGCGTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003543.3-47s21c1
Sequence:CCGGCTAAGCGTCATCGCAAGGTTTCTCGAGAAACCTTGCGATGACGCTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003543.3-131s21c1
Sequence:CCGGTCAAGCGAATTTCTGGCCTTACTCGAGTAAGGCCAGAAATTCGCTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003543.3-47s1c1
Sequence:CCGGCTAAGCGTCATCGCAAGGTTTCTCGAGAAACCTTGCGATGACGCTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003543.3-83s1c1
Sequence:CCGGAGGGCATCACTAAGCCAGCTACTCGAGTAGCTGGCTTAGTGATGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003543.3-29s21c1
Sequence:CCGGGTTTGGGTAAGGGAGGAGCTACTCGAGTAGCTCCTCCCTTACCCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003543.3-85s21c1
Sequence:CCGGGGCATCACTAAGCCAGCTATCCTCGAGGATAGCTGGCTTAGTGATGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003543.3-203s21c1
Sequence:CCGGGTGACGCTGTCACTTACACAGCTCGAGCTGTGTAAGTGACAGCGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003543
VALIDATED
HIST1H4H MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H4h
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003543.3-132s1c1
Sequence:CCGGCAAGCGAATTTCTGGCCTTATCTCGAGATAAGGCCAGAAATTCGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003543.3-41s1c1
Sequence:CCGGGAGGAGCTAAGCGTCATCGCACTCGAGTGCGATGACGCTTAGCTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003543.3-202s1c1
Sequence:CCGGCGTGACGCTGTCACTTACACACTCGAGTGTGTAAGTGACAGCGTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003543.3-47s21c1
Sequence:CCGGCTAAGCGTCATCGCAAGGTTTCTCGAGAAACCTTGCGATGACGCTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003543.3-131s21c1
Sequence:CCGGTCAAGCGAATTTCTGGCCTTACTCGAGTAAGGCCAGAAATTCGCTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003543.3-47s1c1
Sequence:CCGGCTAAGCGTCATCGCAAGGTTTCTCGAGAAACCTTGCGATGACGCTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003543.3-83s1c1
Sequence:CCGGAGGGCATCACTAAGCCAGCTACTCGAGTAGCTGGCTTAGTGATGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003543.3-29s21c1
Sequence:CCGGGTTTGGGTAAGGGAGGAGCTACTCGAGTAGCTCCTCCCTTACCCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003543.3-85s21c1
Sequence:CCGGGGCATCACTAAGCCAGCTATCCTCGAGGATAGCTGGCTTAGTGATGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003543.3-203s21c1
Sequence:CCGGGTGACGCTGTCACTTACACAGCTCGAGCTGTGTAAGTGACAGCGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003543
VALIDATED
HIST1H4H MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H4h
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003543.3-132s1c1
Sequence:CCGGCAAGCGAATTTCTGGCCTTATCTCGAGATAAGGCCAGAAATTCGCTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003543.3-41s1c1
Sequence:CCGGGAGGAGCTAAGCGTCATCGCACTCGAGTGCGATGACGCTTAGCTCCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003543.3-202s1c1
Sequence:CCGGCGTGACGCTGTCACTTACACACTCGAGTGTGTAAGTGACAGCGTCACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003543.3-47s21c1
Sequence:CCGGCTAAGCGTCATCGCAAGGTTTCTCGAGAAACCTTGCGATGACGCTTAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003543.3-131s21c1
Sequence:CCGGTCAAGCGAATTTCTGGCCTTACTCGAGTAAGGCCAGAAATTCGCTTGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003543.3-47s1c1
Sequence:CCGGCTAAGCGTCATCGCAAGGTTTCTCGAGAAACCTTGCGATGACGCTTAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003543.3-83s1c1
Sequence:CCGGAGGGCATCACTAAGCCAGCTACTCGAGTAGCTGGCTTAGTGATGCCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003543.3-29s21c1
Sequence:CCGGGTTTGGGTAAGGGAGGAGCTACTCGAGTAGCTCCTCCCTTACCCAAACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003543.3-85s21c1
Sequence:CCGGGGCATCACTAAGCCAGCTATCCTCGAGGATAGCTGGCTTAGTGATGCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003543.3-203s21c1
Sequence:CCGGGTGACGCTGTCACTTACACAGCTCGAGCTGTGTAAGTGACAGCGTCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153173
HIST1H4H MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H4h
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153173.1-124s1c1
Sequence:CCGGCCGCAAAGTGCTGCGTGACAACTCGAGTTGTCACGCAGCACTTTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153173.1-274s1c1
Sequence:CCGGCGCCGTCACCTACACGGAGCACTCGAGTGCTCCGTGTAGGTGACGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153173.1-136s1c1
Sequence:CCGGGCGTGACAACATCCAGGGCATCTCGAGATGCCCTGGATGTTGTCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153173.1-235s1c1
Sequence:CCGGCGGTGTGCTGAAGGTGTTCCTCTCGAGAGGAACACCTTCAGCACACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153173.1-241s1c1
Sequence:CCGGGCTGAAGGTGTTCCTGGAGAACTCGAGTTCTCCAGGAACACCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153173
HIST1H4H MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H4h
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153173.1-124s1c1
Sequence:CCGGCCGCAAAGTGCTGCGTGACAACTCGAGTTGTCACGCAGCACTTTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153173.1-274s1c1
Sequence:CCGGCGCCGTCACCTACACGGAGCACTCGAGTGCTCCGTGTAGGTGACGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153173.1-136s1c1
Sequence:CCGGGCGTGACAACATCCAGGGCATCTCGAGATGCCCTGGATGTTGTCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153173.1-235s1c1
Sequence:CCGGCGGTGTGCTGAAGGTGTTCCTCTCGAGAGGAACACCTTCAGCACACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153173.1-241s1c1
Sequence:CCGGGCTGAAGGTGTTCCTGGAGAACTCGAGTTCTCCAGGAACACCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153173
HIST1H4H MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H4h
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153173.1-124s1c1
Sequence:CCGGCCGCAAAGTGCTGCGTGACAACTCGAGTTGTCACGCAGCACTTTGCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153173.1-274s1c1
Sequence:CCGGCGCCGTCACCTACACGGAGCACTCGAGTGCTCCGTGTAGGTGACGGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153173.1-136s1c1
Sequence:CCGGGCGTGACAACATCCAGGGCATCTCGAGATGCCCTGGATGTTGTCACGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153173.1-235s1c1
Sequence:CCGGCGGTGTGCTGAAGGTGTTCCTCTCGAGAGGAACACCTTCAGCACACCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153173.1-241s1c1
Sequence:CCGGGCTGAAGGTGTTCCTGGAGAACTCGAGTTCTCCAGGAACACCTTCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)