EMAIL THIS PAGE TO A FRIEND

HIST1H4K

histone cluster 1, H4k

18 Gene Product Result for
Synonyms: H4/d H4F2iii H4FD dJ160A22.1
Gene ID:
Human(8362) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a member of the histone H4 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the small histone gene cluster on chromosome 6p22-p21.3. [provided by RefSeq, Jul 2008]
Mouse(319160) histone cluster 1, H4k
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003541 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003541 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003541 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178211 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178211 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178211 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU171251 MISSION® esiRNA esiRNA targeting mouse Hist1h4k mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003541 Rosetta Predictions human pricing
NM_178211 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003541 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056080 predicted 308
2 SASI_Hs01_00056082 predicted 131
3 SASI_Hs01_00056083 predicted 56
4 SASI_Hs01_00056086 predicted 53
5 SASI_Hs01_00056087 predicted 129
6 SASI_Hs01_00056088 predicted 283
7 SASI_Hs02_00335812 predicted 304
8 SASI_Hs02_00335813 predicted 285
9 SASI_Hs01_00056081 predicted 298
10 SASI_Hs01_00056084 predicted 306
11 SASI_Hs01_00056085 predicted 61
12 SASI_Hs01_00056089 predicted 310
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178211 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056360 predicted 18
2 SASI_Mm01_00056361 predicted 17
3 SASI_Mm01_00056362 predicted 12
4 SASI_Mm01_00056363 predicted 25
5 SASI_Mm01_00056364 predicted 17
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003541
VALIDATED
HIST1H4K MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H4k
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003541.2-69s1c1
Sequence:CCGGGCGCGACAATATCCAGGGCATCTCGAGATGCCCTGGATATTGTCGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003541.2-46s1c1
Sequence:CCGGGCTAAGCGCCACCGTAAAGTACTCGAGTACTTTACGGTGGCGCTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003541.2-75s1c1
Sequence:CCGGCAATATCCAGGGCATCACCAACTCGAGTTGGTGATGCCCTGGATATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003541.2-59s1c1
Sequence:CCGGGTAAAGTACTGCGCGACAATACTCGAGTATTGTCGCGCAGTACTTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003541.2-58s1c1
Sequence:CCGGCGTAAAGTACTGCGCGACAATCTCGAGATTGTCGCGCAGTACTTTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003541.2-204s21c1
Sequence:CCGGGGACGCCGTGACCTATACAGACTCGAGTCTGTATAGGTCACGGCGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003541.2-257s21c1
Sequence:CCGGATGTGGTCTACGCGCTCAAGCCTCGAGGCTTGAGCGCGTAGACCACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003541.2-180s21c1
Sequence:CCGGGGTGTTCCTGGAGAACGTGATCTCGAGATCACGTTCTCCAGGAACACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003541.2-139s21c1
Sequence:CCGGATCTCCGGCCTCATCTACGAGCTCGAGCTCGTAGATGAGGCCGGAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003541
VALIDATED
HIST1H4K MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H4k
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003541.2-69s1c1
Sequence:CCGGGCGCGACAATATCCAGGGCATCTCGAGATGCCCTGGATATTGTCGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003541.2-46s1c1
Sequence:CCGGGCTAAGCGCCACCGTAAAGTACTCGAGTACTTTACGGTGGCGCTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003541.2-75s1c1
Sequence:CCGGCAATATCCAGGGCATCACCAACTCGAGTTGGTGATGCCCTGGATATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003541.2-59s1c1
Sequence:CCGGGTAAAGTACTGCGCGACAATACTCGAGTATTGTCGCGCAGTACTTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003541.2-58s1c1
Sequence:CCGGCGTAAAGTACTGCGCGACAATCTCGAGATTGTCGCGCAGTACTTTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003541.2-204s21c1
Sequence:CCGGGGACGCCGTGACCTATACAGACTCGAGTCTGTATAGGTCACGGCGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003541.2-257s21c1
Sequence:CCGGATGTGGTCTACGCGCTCAAGCCTCGAGGCTTGAGCGCGTAGACCACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003541.2-180s21c1
Sequence:CCGGGGTGTTCCTGGAGAACGTGATCTCGAGATCACGTTCTCCAGGAACACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003541.2-139s21c1
Sequence:CCGGATCTCCGGCCTCATCTACGAGCTCGAGCTCGTAGATGAGGCCGGAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003541
VALIDATED
HIST1H4K MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H4k
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003541.2-69s1c1
Sequence:CCGGGCGCGACAATATCCAGGGCATCTCGAGATGCCCTGGATATTGTCGCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003541.2-46s1c1
Sequence:CCGGGCTAAGCGCCACCGTAAAGTACTCGAGTACTTTACGGTGGCGCTTAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003541.2-75s1c1
Sequence:CCGGCAATATCCAGGGCATCACCAACTCGAGTTGGTGATGCCCTGGATATTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003541.2-59s1c1
Sequence:CCGGGTAAAGTACTGCGCGACAATACTCGAGTATTGTCGCGCAGTACTTTACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003541.2-58s1c1
Sequence:CCGGCGTAAAGTACTGCGCGACAATCTCGAGATTGTCGCGCAGTACTTTACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003541.2-204s21c1
Sequence:CCGGGGACGCCGTGACCTATACAGACTCGAGTCTGTATAGGTCACGGCGTCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003541.2-257s21c1
Sequence:CCGGATGTGGTCTACGCGCTCAAGCCTCGAGGCTTGAGCGCGTAGACCACATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003541.2-180s21c1
Sequence:CCGGGGTGTTCCTGGAGAACGTGATCTCGAGATCACGTTCTCCAGGAACACCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003541.2-139s21c1
Sequence:CCGGATCTCCGGCCTCATCTACGAGCTCGAGCTCGTAGATGAGGCCGGAGATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178211
VALIDATED
HIST1H4K MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H4k
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178211.1-57s1c1
Sequence:CCGGCCGCAAAGTGCTGCGCGATAACTCGAGTTATCGCGCAGCACTTTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178211.1-30s1c1
Sequence:CCGGGCTCGGTAAAGGTGGCGCCAACTCGAGTTGGCGCCACCTTTACCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178211.1-69s1c1
Sequence:CCGGGCGCGATAACATCCAGGGCATCTCGAGATGCCCTGGATGTTATCGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_178211.1-60s1c1
Sequence:CCGGCAAAGTGCTGCGCGATAACATCTCGAGATGTTATCGCGCAGCACTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178211.1-55s1c1
Sequence:CCGGCACCGCAAAGTGCTGCGCGATCTCGAGATCGCGCAGCACTTTGCGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178211
VALIDATED
HIST1H4K MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H4k
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178211.1-57s1c1
Sequence:CCGGCCGCAAAGTGCTGCGCGATAACTCGAGTTATCGCGCAGCACTTTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178211.1-30s1c1
Sequence:CCGGGCTCGGTAAAGGTGGCGCCAACTCGAGTTGGCGCCACCTTTACCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178211.1-69s1c1
Sequence:CCGGGCGCGATAACATCCAGGGCATCTCGAGATGCCCTGGATGTTATCGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_178211.1-60s1c1
Sequence:CCGGCAAAGTGCTGCGCGATAACATCTCGAGATGTTATCGCGCAGCACTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178211.1-55s1c1
Sequence:CCGGCACCGCAAAGTGCTGCGCGATCTCGAGATCGCGCAGCACTTTGCGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178211
VALIDATED
HIST1H4K MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H4k
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178211.1-57s1c1
Sequence:CCGGCCGCAAAGTGCTGCGCGATAACTCGAGTTATCGCGCAGCACTTTGCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178211.1-30s1c1
Sequence:CCGGGCTCGGTAAAGGTGGCGCCAACTCGAGTTGGCGCCACCTTTACCGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178211.1-69s1c1
Sequence:CCGGGCGCGATAACATCCAGGGCATCTCGAGATGCCCTGGATGTTATCGCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_178211.1-60s1c1
Sequence:CCGGCAAAGTGCTGCGCGATAACATCTCGAGATGTTATCGCGCAGCACTTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178211.1-55s1c1
Sequence:CCGGCACCGCAAAGTGCTGCGCGATCTCGAGATCGCGCAGCACTTTGCGGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)