EMAIL THIS PAGE TO A FRIEND

HIST1H4L

histone cluster 1, H4l

72 Gene Product Result for
Synonyms: H4.k H4/k H4FK
Gene ID:
Human(8368) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a member of the histone H4 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the small histone gene cluster on chromosome 6p22-p21.3. [provided by RefSeq, Jul 2008]
Zebrafish(100126027) histone 1, H4, like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003546 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003546 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003546 MISSION® shRNA Lentiviral Transduction Particles human pricing

Related Products

Product # Description Species Add to Cart
 
17-211 Acetyl-Histone H4 Antibody Set Routinely tested by immunoblot analysis on acid extracts of HeLa cells treated with sodium butyrate. pricing
17-229 Acetyl-Histone H4 Immunoprecipitation (ChIP) Assay Kit Acetyl-Histone H4 Immunoprecipitation (ChIP) Assay Kit used to immunoprecipitate transcriptionally active chromatin from mammalian cells using anti-Acetyl-Histone H4, ChIP grade rabbit antiserum. pricing
12-346 Acetyl-Histone H4 (Lys16) Peptide Acetyl-Histone H4 (Lys16) Peptide primarily used in Histone Acetyltransferase Assays (HAT) and Western Blotting. pricing
12-353 Acetyl-Histone H4 (Lys5, 8, 12, 16) Peptide Acetyl-Histone H4 (Lys5, 8, 12, 16) Peptide primarily used in Histone Acetyltransferase Assays (HAT). pricing
12-379 Acetyl-Histone H4 (Lys5, 8, 12, 16) Peptide, biotin conjugate Acetyl-Histone H4 (Lys5, 8, 12, 16) Peptide, biotin conjugate primarily used in Immunoprecipitation and Affinity Precipitation Assays. pricing
12-343 Acetyl-Histone H4 (Lys5) Peptide Acetyl-Histone H4 (Lys5) Peptide primarily used in Histone Acetyltransferase Assays (HAT). pricing
12-344 Acetyl-Histone H4 (Lys8) Peptide Acetyl-Histone H4 (Lys8) Peptide primarily used in Histone Acetyltransferase Assays (HAT) and Western Blotting. pricing
17-212 Acetyl-Histone H4 Peptide Pack Routinely evaluated in a peptide inhibition. pricing
06-598 Anti-acetyl-Histone H4 Antibody Anti-acetyl-Histone H4 Antibody is a Rabbit Polyclonal Antibody for detection of acetyl-Histone H4 also known as H4 histone family member A, histone 1-H4a & has been validated in ChIP, ICC, IP & WB. pricing
06-866 Anti-acetyl-Histone H4 Antibody Use Anti-acetyl-Histone H4 Antibody (Rabbit Polyclonal Antibody) has been published and validated in ChIP, WB, ICC to detect acetyl-Histone H4 also known as H4 histone family member A, histone 1-H4a. pricing
04-557 Anti-acetyl-Histone H4 Antibody, pan (Lys 5,8,12), rabbit monoclonal Anti-acetyl-Histone H4 Antibody, pan (Lys 5, 8, 12) detects level of acetyl-Histone H4 & has been published & validated for use in WB. pricing
06-1352-I Anti-acetyl Histone H4 (Lys12) Antibody This Anti-acetyl Histone H4 (Lys12) Antibody is validated for use in western blotting, ICC & dot blot for the detection of acetyl Histone H4 (Lys12). pricing
07-595 Anti-acetyl-Histone H4 (Lys12) Antibody Use Anti-acetyl-Histone H4 (Lys12) Antibody (Rabbit Polyclonal Antibody) validated in ChIP, DB, WB, ChIP-seq to detect acetyl-Histone H4 (Lys12) also known as H4K12Ac, Histone H4 (acetyl K12). pricing
04-119 Anti-acetyl-Histone H4 (Lys12) Antibody, rabbit monoclonal This Anti-acetyl-Histone H4 (Lys12) Antibody, rabbit is validated for use in WB for the detection of acetyl-Histone H4 (Lys12). pricing
06-1352-IS Anti-acetyl Histone H4 (Lys12) Antibody, Trial Size This Anti-acetyl Histone H4 (Lys12) Antibody, Trial Size is validated for use in western blotting, ICC & dot blot for the detection of acetyl Histone H4 (Lys12). pricing
04-119-S Anti-acetyl-Histone H4 (Lys12) Antibody, Trial Size, rabbit monoclonal This Anti-acetyl-Histone H4 (Lys12) Antibody, Trial Size / Pack is validated for use in WB for the detection of acetyl-Histone H4 (Lys12). pricing
07-329 Anti-acetyl-Histone H4 (Lys16) Antibody Anti-acetyl-Histone H4 (Lys16) Antibody is a rabbit polyclonal antibody for detection of acetyl-Histone H4 (Lys16) also known as H4K16Ac, Histone H4 (acetyl K16 & has been published and validated in ChIP, WB, Mplex, PIA, DB, ChIP-seq. pricing
05-1355 Anti-acetyl Histone H4 (Lys5/8/12/16) Antibody, clone 3HH4-4C10 Use Anti-acetyl Histone H4 (Lys5/8/12/16) Antibody, clone 3HH4-4C10 (mouse monoclonal antibody) validated in WB, ICC to detect acetyl Histone H4 (Lys5/8/12/16) also known as H4KAc, Histone H4 (acetyl). pricing
07-327 Anti-acetyl-Histone H4 (Lys5) Antibody Use Anti-acetyl-Histone H4 (Lys5) Antibody (Rabbit Polyclonal Antibody) validated in WB, DB, ICC, ChIP-seq, ChIP to detect acetyl-Histone H4 (Lys5) also known as H4K5Ac, Histone H4 (acetyl K5). pricing
04-118 Anti-acetyl-Histone H4 (Lys5) Antibody, rabbit monoclonal Detect acetyl-Histone H4 (Lys5) using this Anti-acetyl-Histone H4 (Lys5) Antibody, rabbit validated for use in WB. pricing
07-328 Anti-acetyl-Histone H4 (Lys8) Antibody Use Anti-acetyl-Histone H4 (Lys8) Antibody (Rabbit Polyclonal Antibody) validated in ChIP, IP, WB, DB, ChIP-seq to detect acetyl-Histone H4 (Lys8) also known as H4K8Ac, Histone H4 (acetyl K8). pricing
ABE361 Anti-acetyl-Histone H4 (Lys91) Antibody Anti-acetyl-Histone H4 is an antibody against acetyl-Histone H4 for use in WB & Dot Blot. pricing
ABE323 Anti-dimethyl Histone H4 Antibody (Arg17) Detect Histone H4 using this rabbit polyclonal antibody, Anti-dimethyl Histone H4 Antibody (Arg17) validated for use in western blotting, Dot Blot & ICC. pricing
ABE321 Anti-dimethyl Histone H4 Antibody (Arg19), Symmetric Detect Histone H4 using this rabbit polyclonal antibody, Anti-dimethyl Histone H4 Antibody (Arg19), Symmetric validated for use in western blotting & Dot Blot. pricing
ABE320 Anti-dimethyl Histone H4 (Arg17) Antibody, symmetric Detect Histone H4 using this rabbit polyclonal antibody, Anti-dimethyl Histone H4 (Arg17) Antibody, symmetric validated for use in western blotting & Dot Blot. pricing
07-213-I Anti-dimethyl-Histone H4 (Arg3) Asymmetric Antibody This Anti-dimethyl-Histone H4 (Arg3) Asymmetric Antibody is validated for use in Western Blotting and Immunoprecipitation and Dot Blot for the detection of dimethyl-Histone H4 (Arg3) Asymmetric. pricing
ABE441 Anti-dimethyl Histone H4 (Arg3), Asymmetric Antibody This Anti-dimethyl Histone H4 (Arg3) antibody, Asymmetric is validated for use in western blotting, ICC & dot blot for the detection of dimethyl Histone H4 (Arg3). pricing
07-213-IS Anti-dimethyl-Histone H4 (Arg3) Asymmetric (Trial Size) Antibody This Anti-dimethyl-Histone H4 (Arg3) Asymmetric (Trial Size) Antibody is validated for use in Western Blotting and Immunoprecipitation and Dot Blot for the detection of dimethyl-Histone H4 (Arg3) Asymmetric . pricing
ABE441-S Anti-dimethyl Histone H4 (Arg3), Asymmetric, Trial Size Antibody This Anti-dimethyl Histone H4 (Arg3) antibody, Asymmetric, Trial Size is validated for use in western blotting, ICC & dot blot for the detection of dimethyl Histone H4 (Arg3). pricing
07-947 Anti-dimethyl-Histone H4 (Arg3) Symmetric Antibody Use Anti-dimethyl-Histone H4 (Arg3) Symmetric Antibody (rabbit polyclonal antibody) validated in WB, ICC, DB to detect dimethyl-Histone H4 (Arg3) Symmetric also known as histone H4, histone cluster 4 H4. pricing
07-367 Anti-dimethyl-Histone H4 (Lys20) Antibody Use Anti-dimethyl-Histone H4 (Lys20) Antibody (Rabbit Polyclonal Antibody) validated in ChIP, IF, WB, ICC to detect dimethyl-Histone H4 (Lys20) also known as H4K20me2, Histone H4 (di methyl K20). pricing
05-672 Anti-dimethyl-Histone H4 (Lys20) Antibody, clone 6G7/H4 Use Anti-dimethyl-Histone H4 (Lys20) Antibody, clone 6G7/H4 (mouse monoclonal antibody) validated in IP, WB, IHC to detect dimethyl-Histone H4 (Lys20) also known as H4K20me2, Histone H4 (di methyl K20). pricing
07-108 Anti-Histone H4 Antibody Use Anti-Histone H4 Antibody (Rabbit Polyclonal Antibody) validated in WB to detect Histone H4 also known as Histone H4. pricing
05-858R Anti-Histone H4 Antibody, pan, clone 62-10C-2, rabbit monoclonal Use Anti-Histone H4 Antibody, pan, clone 62-10C-2 (Rabbit Monoclonal Antibody) validated in WB to detect Histone H4 also known as Histone H4. pricing
04-858 Anti-Histone H4 Antibody, pan, rabbit monoclonal Anti-Histone H4 Antibody, pan is a Rabbit Monoclonal Antibody for detection of Histone H4 also known as Histone H4 & has been validated in ChIP, WB, Mplex. pricing
07-596 Anti-Histone H4 (citrulline 3) Antibody Anti-Histone H4 (Citrulline 3) Antibody, Cat. No. 07-596, is a highly specific rabbit polyclonal antibody that targets histone H4 citrullination (H4Cit3) and has been tested in Chromatin Immunoprecipitation (ChIP), Immunocytochemistry, Immunohistochemistry, and Western Blotting. pricing
06-946 Anti-hyperacetylated Histone H4 (Penta) Antibody Use Anti-hyperacetylated Histone H4 (Penta) Antibody (Rabbit Polyclonal Antibody) validated in ChIP, ICC, WB to detect hyperacetylated Histone H4 (Penta) also known as H4 histone family member A. pricing
ABE362 Anti-monomethyl Histone H4 (Arg3) Antibody This Anti-monomethyl Histone H4 (Arg3) Antibody is validated for use in western blotting, dot blot & ICC for the detection of monomethyl Histone H4 (Arg3). pricing
07-748-AF555 Anti-monomethyl Histone H4 (Lys20), Alexa Fluor® 555 conjugate Anti-monomethyl Histone H4 (Lys20), Alexa Fluor® 555 conjugate is an antibody against monomethyl Histone H4 (Lys20), Alexa Fluor® 555 conjugate for use in Immunocytochemistry. pricing
07-748 Anti-monomethyl-Histone H4 (Lys20) Antibody Anti-monomethyl-Histone H4 (Lys20) Antibody is a rabbit polyclonal antibody for detection of monomethyl-Histone H4 (Lys20) also known as H4K20me1, Histone H4 (mono methyl K20) & has been validated in WB, Mplex, ICC. pricing
07-748-AF488 Anti-monomethyl Histone H4 (Lys20) Antibody, Alexa Fluor® 488 conjugate Anti-monomethyl Histone H4 (Lys20) Antibody, Alexa Fluor® 488 conjugate is an antibody against monomethyl Histone H4 (Lys20) for use in Immunocytochemistry. pricing
07-748-AF647 Anti-monomethyl Histone H4 (Lys20) Antibody, Alexa Fluor® 647 Conjugate This Anti-monomethyl Histone H4 (Lys20) Antibody, Alexa Fluor® 647 Conjugate is validated for use in ICC for the detection of monomethyl Histone H4 (Lys20). pricing
04-735 Anti-monomethyl-Histone H4 (Lys20) Antibody, clone NL314, rabbit monoclonal Use Anti-monomethyl-Histone H4 (Lys20) Antibody, clone NL314 (rabbit monoclonal antibody) validated in WB, Mplex to detect monomethyl-Histone H4 (Lys20) also known as H4K20me1, Histone H4 (mono methyl K20). pricing
ABE2909 Anti-phospho Histone H4 (Tyr51) Anti-phospho Histone H4 (Tyr51) Antibody, Cat. No. ABE2909, is a highly specific rabbit polyclonal antibody that targets Histone H4 phosphorylated on Tyr51 and has been tested for use in in Immunocytochemistry, Immunofluorescence, and Western Blotting. pricing
07-463 Anti-trimethyl-Histone H4 (Lys20) Antibody Anti-trimethyl-Histone H4 (Lys20) Antibody is a rabbit polyclonal antibody for detection of trimethyl-Histone H4 (Lys20) also known as H4K20me3, Histone H4 (tri methyl K20) & has been validated in IP, WB, ChIP, DB. pricing
04-079 Anti-trimethyl-Histone H4 (Lys20), Antibody, rabbit monoclonal Detect trimethyl-Histone H4 (Lys20) using this Anti-trimethyl-Histone H4 (Lys20) Antibody, rabbit demontrated performance in WB, ChIP & DB. pricing
07-463-S Anti-trimethyl-Histone H4 (Lys20) Antibody, Trial Size Anti-trimethyl-Histone H4 (Lys20) Antibody, Trial Size/ Pack is a rabbit polyclonal antibody for detection of trimethyl-Histone H4 (Lys20) also known as H4K20me3, Histone H4 (tri methyl K20) & has been validated in IP, WB, ChIP, DB. pricing
04-079-S Anti-trimethyl-Histone H4 (Lys20) Antibody, Trial Size, rabbit monoclonal Detect trimethyl-Histone H4 (Lys20) using this Anti-trimethyl-Histone H4 (Lys20) Antibody, rabbit monoclonal demontrated performance in WB, ChIP, & DB. pricing
17-10121 ChIPAb+ Acetyl-Histone H4 (Lys12) - ChIP Validated Antibody and Primer Set, rabbit monoclonal This ChIPAb+ Acetyl-Histone H4 (Lys12) -ChIP Validated Antibody & Primer Set conveniently includes the antibody & the specific control PCR primers. pricing
17-10101 ChIPAb+ Acetyl-Histone H4 (Lys16) - ChIP Validated Antibody and Primer Set This ChIPAb+ Acetyl-Histone H4 (Lys16) -ChIP Validated Antibody & Primer Set conveniently includes the antibody & the specific control PCR primers. pricing
17-10099 ChIPAb+ Acetyl-Histone H4 (Lys8) - ChIP Validated Antibody and Primer Set The ChIPAb+ Acetyl-Histone H4 (Lys8) set includes the Acetyl-Histone H4 (Lys8) antibody, a negative control rabbit serum & qPCR primers which amplify a 134 bp region of human HSPCA. pricing
17-10250 ChIPAb+™ Dimethyl-Histone H4 (Arg3) Symmetric - ChIP Validated Antibody and Primer Set This ChIPAb+ Dimethyl-Histone H4 (Arg3) Symmetric -ChIP Validated Antibody & Primer Set conveniently includes the antibody & the specific control PCR primers. pricing
17-10047 ChIPAb+ Histone H4 - ChIP Validated Antibody and Primer Set, rabbit monoclonal This ChIPAb+ Histone H4 -ChIP Validated Antibody & Primer Set conveniently includes the antibody & the specific control PCR primers. pricing
12-347 Histone H4 Peptide Histone H4 Peptide primarily used in Histone Acetyltransferase Assays (HAT) and Western Blotting. pricing
12-405 Histone H4 Peptide, biotin conjugate This gene is intronless & encodes a member of the histone H4 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. pricing
12-372 Histone H4 Peptide, biotin conjugate, residues 2-24 Histone H4 Peptide, biotin conjugate, residues 2-24 primarily used in Immunoprecipitation and Affinity Precipitation Assays. pricing
14-697 Histone H4 Protein, human recombinant, 1 mg Recombinant human histone H4 produced in E. coli, purified by FPLC. For use in Enzyme Assays & Western Blotting. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003546 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003546 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00247524 predicted 298
2 SASI_Hs01_00247525 predicted 52
3 SASI_Hs01_00247526 predicted 145
4 SASI_Hs01_00247527 predicted 53
5 SASI_Hs01_00247529 predicted 289
6 SASI_Hs01_00247532 predicted 53
7 SASI_Hs02_00335817 predicted 143
8 SASI_Hs02_00335818 predicted 130
9 SASI_Hs01_00247530 predicted 158
10 SASI_Hs02_00335819 predicted 127
11 SASI_Hs01_00247528 predicted 68
12 SASI_Hs01_00247531 predicted 174
13 SASI_Hs01_00247533 predicted 166
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003546
HIST1H4L MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H4l
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003546.2-167s1c1
Sequence:CCGGCGCGGAGTTCTTAAAGTGTTTCTCGAGAAACACTTTAAGAACTCCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003546.2-64s1c1
Sequence:CCGGAGTTCTGCGCGACAACATTCACTCGAGTGAATGTTGTCGCGCAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003546.2-114s1c1
Sequence:CCGGTGGCACGGCGTGGAGGCGTTACTCGAGTAACGCCTCCACGCCGTGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003546.2-144s1c1
Sequence:CCGGCAGGCCTTATATACGAGGAGACTCGAGTCTCCTCGTATATAAGGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003546.2-136s1c1
Sequence:CCGGGCGCATCTCAGGCCTTATATACTCGAGTATATAAGGCCTGAGATGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003546
HIST1H4L MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H4l
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003546.2-167s1c1
Sequence:CCGGCGCGGAGTTCTTAAAGTGTTTCTCGAGAAACACTTTAAGAACTCCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003546.2-64s1c1
Sequence:CCGGAGTTCTGCGCGACAACATTCACTCGAGTGAATGTTGTCGCGCAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003546.2-114s1c1
Sequence:CCGGTGGCACGGCGTGGAGGCGTTACTCGAGTAACGCCTCCACGCCGTGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003546.2-144s1c1
Sequence:CCGGCAGGCCTTATATACGAGGAGACTCGAGTCTCCTCGTATATAAGGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003546.2-136s1c1
Sequence:CCGGGCGCATCTCAGGCCTTATATACTCGAGTATATAAGGCCTGAGATGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003546
HIST1H4L MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H4l
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003546.2-167s1c1
Sequence:CCGGCGCGGAGTTCTTAAAGTGTTTCTCGAGAAACACTTTAAGAACTCCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003546.2-64s1c1
Sequence:CCGGAGTTCTGCGCGACAACATTCACTCGAGTGAATGTTGTCGCGCAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003546.2-114s1c1
Sequence:CCGGTGGCACGGCGTGGAGGCGTTACTCGAGTAACGCCTCCACGCCGTGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003546.2-144s1c1
Sequence:CCGGCAGGCCTTATATACGAGGAGACTCGAGTCTCCTCGTATATAAGGCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003546.2-136s1c1
Sequence:CCGGGCGCATCTCAGGCCTTATATACTCGAGTATATAAGGCCTGAGATGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)