EMAIL THIS PAGE TO A FRIEND

HIST1H4L

histone cluster 1, H4l

13 Gene Product Result for
Synonyms: H4.k H4/k H4FK
Gene ID:
Human(8368) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a member of the histone H4 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in the small histone gene cluster on chromosome 6p22-p21.3. [provided by RefSeq, Jul 2008]
Zebrafish(100126027) histone 1, H4, like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003546 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003546 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003546 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003546 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003546 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00247524 predicted 298
2 SASI_Hs01_00247525 predicted 52
3 SASI_Hs01_00247526 predicted 145
4 SASI_Hs01_00247527 predicted 53
5 SASI_Hs01_00247529 predicted 289
6 SASI_Hs01_00247532 predicted 53
7 SASI_Hs02_00335817 predicted 143
8 SASI_Hs02_00335818 predicted 130
9 SASI_Hs01_00247530 predicted 158
10 SASI_Hs02_00335819 predicted 127
11 SASI_Hs01_00247528 predicted 68
12 SASI_Hs01_00247531 predicted 174
13 SASI_Hs01_00247533 predicted 166
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003546
HIST1H4L MISSION shRNA Bacterial Glycerol Stock
histone cluster 1, H4l
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003546.2-167s1c1
Sequence:CCGGCGCGGAGTTCTTAAAGTGTTTCTCGAGAAACACTTTAAGAACTCCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003546.2-136s1c1
Sequence:CCGGGCGCATCTCAGGCCTTATATACTCGAGTATATAAGGCCTGAGATGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003546.2-64s1c1
Sequence:CCGGAGTTCTGCGCGACAACATTCACTCGAGTGAATGTTGTCGCGCAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003546.2-144s1c1
Sequence:CCGGCAGGCCTTATATACGAGGAGACTCGAGTCTCCTCGTATATAAGGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003546.2-114s1c1
Sequence:CCGGTGGCACGGCGTGGAGGCGTTACTCGAGTAACGCCTCCACGCCGTGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003546
HIST1H4L MISSION shRNA shRNA Plasmid DNA
histone cluster 1, H4l
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003546.2-167s1c1
Sequence:CCGGCGCGGAGTTCTTAAAGTGTTTCTCGAGAAACACTTTAAGAACTCCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003546.2-136s1c1
Sequence:CCGGGCGCATCTCAGGCCTTATATACTCGAGTATATAAGGCCTGAGATGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003546.2-64s1c1
Sequence:CCGGAGTTCTGCGCGACAACATTCACTCGAGTGAATGTTGTCGCGCAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003546.2-144s1c1
Sequence:CCGGCAGGCCTTATATACGAGGAGACTCGAGTCTCCTCGTATATAAGGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003546.2-114s1c1
Sequence:CCGGTGGCACGGCGTGGAGGCGTTACTCGAGTAACGCCTCCACGCCGTGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003546
HIST1H4L MISSION shRNA Lentiviral Transduction Particles
histone cluster 1, H4l
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003546.2-167s1c1
Sequence:CCGGCGCGGAGTTCTTAAAGTGTTTCTCGAGAAACACTTTAAGAACTCCGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003546.2-136s1c1
Sequence:CCGGGCGCATCTCAGGCCTTATATACTCGAGTATATAAGGCCTGAGATGCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003546.2-64s1c1
Sequence:CCGGAGTTCTGCGCGACAACATTCACTCGAGTGAATGTTGTCGCGCAGAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003546.2-144s1c1
Sequence:CCGGCAGGCCTTATATACGAGGAGACTCGAGTCTCCTCGTATATAAGGCCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003546.2-114s1c1
Sequence:CCGGTGGCACGGCGTGGAGGCGTTACTCGAGTAACGCCTCCACGCCGTGCCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)