EMAIL THIS PAGE TO A FRIEND

HIST2H2AA3

histone cluster 2, H2aa3

30 Gene Product Result for
Synonyms: H2A H2A.2 H2A/O H2A/q H2AFO H2a-615 HIST2H2AA
UniProtKB ID: Q6FI13, B2R5F0, P20670
Gene ID:
Human(8337) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a member of the histone H2A family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in a histone cluster on chromosome 1. This gene is one of four histone genes in the cluster that are duplicated; this record represents the centromeric copy. [provided by RefSeq, Jul 2008]
Rat(365877) histone cluster 2, H2aa3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003516 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003516 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003516 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU229801 MISSION® esiRNA esiRNA targeting human HIST2H2AA3 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003516 Rosetta Predictions human pricing
XM_001062079 Rosetta Predictions rat pricing
XM_345255 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003516 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135333 predicted 201
2 SASI_Hs01_00135334 predicted 203
3 SASI_Hs01_00135335 predicted 437
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062079 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00302317 predicted 221
2 SASI_Rn02_00302318 predicted 282
3 SASI_Rn02_00302319 predicted 286
4 SASI_Rn02_00302320 predicted 289
5 SASI_Rn02_00302321 predicted 280
6 SASI_Rn02_00302322 predicted 284
7 SASI_Rn02_00302323 predicted 222
8 SASI_Rn02_00302324 predicted 214
9 SASI_Rn02_00302325 predicted 293
10 SASI_Rn02_00302326 predicted 289
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345255 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398106 predicted 220
2 SASI_Rn02_00398107 predicted 284
3 SASI_Rn02_00398108 predicted 284
4 SASI_Rn02_00398109 predicted 293
5 SASI_Rn02_00398110 predicted 284
6 SASI_Rn02_00398111 predicted 288
7 SASI_Rn02_00398112 predicted 219
8 SASI_Rn02_00398113 predicted 219
9 SASI_Rn02_00398114 predicted 293
10 SASI_Rn02_00398115 predicted 285
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003516
HIST2H2AA3 MISSION shRNA Bacterial Glycerol Stock
histone cluster 2, H2aa3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003516.2-272s1c1
Sequence:CCGGCAACAAGAAGACGCGCATCATCTCGAGATGATGCGCGTCTTCTTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003516.2-221s1c1
Sequence:CCGGCGAGTATCTGACCGCCGAGATCTCGAGATCTCGGCGGTCAGATACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003516.2-117s1c1
Sequence:CCGGGCTGGCCTTCAGTTCCCGGTACTCGAGTACCGGGAACTGAAGGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003516.2-333s1c1
Sequence:CCGGCTGAACAAGCTGCTGGGCAAACTCGAGTTTGCCCAGCAGCTTGTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003516.2-312s1c1
Sequence:CCGGGCCATCCGCAACGACGAGGAACTCGAGTTCCTCGTCGTTGCGGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003516.2-426s21c1
Sequence:CCGGCACAAGGCAAAGGGCAAGTGACTCGAGTCACTTGCCCTTTGCCTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003516.2-418s21c1
Sequence:CCGGAGAGTCACCACAAGGCAAAGGCTCGAGCCTTTGCCTTGTGGTGACTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003516.2-394s21c1
Sequence:CCGGCCGTACTGCTCCCTAAGAAGACTCGAGTCTTCTTAGGGAGCAGTACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003516
HIST2H2AA3 MISSION shRNA shRNA Plasmid DNA
histone cluster 2, H2aa3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003516.2-272s1c1
Sequence:CCGGCAACAAGAAGACGCGCATCATCTCGAGATGATGCGCGTCTTCTTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003516.2-221s1c1
Sequence:CCGGCGAGTATCTGACCGCCGAGATCTCGAGATCTCGGCGGTCAGATACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003516.2-117s1c1
Sequence:CCGGGCTGGCCTTCAGTTCCCGGTACTCGAGTACCGGGAACTGAAGGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003516.2-333s1c1
Sequence:CCGGCTGAACAAGCTGCTGGGCAAACTCGAGTTTGCCCAGCAGCTTGTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003516.2-312s1c1
Sequence:CCGGGCCATCCGCAACGACGAGGAACTCGAGTTCCTCGTCGTTGCGGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003516.2-426s21c1
Sequence:CCGGCACAAGGCAAAGGGCAAGTGACTCGAGTCACTTGCCCTTTGCCTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003516.2-418s21c1
Sequence:CCGGAGAGTCACCACAAGGCAAAGGCTCGAGCCTTTGCCTTGTGGTGACTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003516.2-394s21c1
Sequence:CCGGCCGTACTGCTCCCTAAGAAGACTCGAGTCTTCTTAGGGAGCAGTACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003516
HIST2H2AA3 MISSION shRNA Lentiviral Transduction Particles
histone cluster 2, H2aa3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003516.2-272s1c1
Sequence:CCGGCAACAAGAAGACGCGCATCATCTCGAGATGATGCGCGTCTTCTTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003516.2-221s1c1
Sequence:CCGGCGAGTATCTGACCGCCGAGATCTCGAGATCTCGGCGGTCAGATACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003516.2-117s1c1
Sequence:CCGGGCTGGCCTTCAGTTCCCGGTACTCGAGTACCGGGAACTGAAGGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003516.2-333s1c1
Sequence:CCGGCTGAACAAGCTGCTGGGCAAACTCGAGTTTGCCCAGCAGCTTGTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003516.2-312s1c1
Sequence:CCGGGCCATCCGCAACGACGAGGAACTCGAGTTCCTCGTCGTTGCGGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003516.2-426s21c1
Sequence:CCGGCACAAGGCAAAGGGCAAGTGACTCGAGTCACTTGCCCTTTGCCTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003516.2-418s21c1
Sequence:CCGGAGAGTCACCACAAGGCAAAGGCTCGAGCCTTTGCCTTGTGGTGACTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003516.2-394s21c1
Sequence:CCGGCCGTACTGCTCCCTAAGAAGACTCGAGTCTTCTTAGGGAGCAGTACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)