EMAIL THIS PAGE TO A FRIEND

HIST2H2AA4

histone cluster 2, H2aa4

7 Gene Product Result for
Synonyms: H2A/R
Gene ID:
Human(723790) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a member of the histone H2A family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. This gene is found in a histone cluster on chromosome 1. This gene is one of four histone genes in the cluster that are duplicated; this record represents the telomeric copy. [provided by RefSeq, Jul 2008]
dog(608631) histone cluster 2, H2aa4
cow(100297758) histone cluster 2, H2aa4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4504674 Anti-phospho-Histone H2A (pThr121) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001040874 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001040874 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001040874 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU217401 MISSION® esiRNA esiRNA targeting human HIST2H2AA4 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040874 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040874 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309159 predicted 208
2 SASI_Hs02_00309160 predicted 199
3 SASI_Hs02_00309161 predicted 434
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001040874
HIST2H2AA4 MISSION shRNA Bacterial Glycerol Stock
histone cluster 2, H2aa4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040874.1-145s21c1
Sequence:CCGGTGCATCGCTTGCTGCGCAAAGCTCGAGCTTTGCGCAGCAAGCGATGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040874.1-335s21c1
Sequence:CCGGGAACAAGCTGCTGGGCAAAGTCTCGAGACTTTGCCCAGCAGCTTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040874.1-153s21c1
Sequence:CCGGTTGCTGCGCAAAGGCAACTACCTCGAGGTAGTTGCCTTTGCGCAGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040874.1-271s21c1
Sequence:CCGGACAACAAGAAGACGCGCATCACTCGAGTGATGCGCGTCTTCTTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040874.1-322s21c1
Sequence:CCGGACGACGAGGAACTGAACAAGCCTCGAGGCTTGTTCAGTTCCTCGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001040874
HIST2H2AA4 MISSION shRNA shRNA Plasmid DNA
histone cluster 2, H2aa4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040874.1-145s21c1
Sequence:CCGGTGCATCGCTTGCTGCGCAAAGCTCGAGCTTTGCGCAGCAAGCGATGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040874.1-335s21c1
Sequence:CCGGGAACAAGCTGCTGGGCAAAGTCTCGAGACTTTGCCCAGCAGCTTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040874.1-153s21c1
Sequence:CCGGTTGCTGCGCAAAGGCAACTACCTCGAGGTAGTTGCCTTTGCGCAGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040874.1-271s21c1
Sequence:CCGGACAACAAGAAGACGCGCATCACTCGAGTGATGCGCGTCTTCTTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040874.1-322s21c1
Sequence:CCGGACGACGAGGAACTGAACAAGCCTCGAGGCTTGTTCAGTTCCTCGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001040874
HIST2H2AA4 MISSION shRNA Lentiviral Transduction Particles
histone cluster 2, H2aa4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040874.1-145s21c1
Sequence:CCGGTGCATCGCTTGCTGCGCAAAGCTCGAGCTTTGCGCAGCAAGCGATGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040874.1-335s21c1
Sequence:CCGGGAACAAGCTGCTGGGCAAAGTCTCGAGACTTTGCCCAGCAGCTTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040874.1-153s21c1
Sequence:CCGGTTGCTGCGCAAAGGCAACTACCTCGAGGTAGTTGCCTTTGCGCAGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040874.1-271s21c1
Sequence:CCGGACAACAAGAAGACGCGCATCACTCGAGTGATGCGCGTCTTCTTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040874.1-322s21c1
Sequence:CCGGACGACGAGGAACTGAACAAGCCTCGAGGCTTGTTCAGTTCCTCGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)