EMAIL THIS PAGE TO A FRIEND

HIST2H2AB

histone cluster 2, H2ab

40 Gene Product Result for
Synonyms: H2AB
UniProtKB ID: Q8IUE6
Gene ID:
Human(317772) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a member of the histone H2A family. Transcripts from this gene contain a palindromic termination element. [provided by RefSeq, Jul 2008]
Mouse(621893) histone cluster 2, H2ab
Rat(690102) histone cluster 2, H2ab
dog(483175) histone cluster 2, H2ab
cow(614974) histone cluster 2, H2ab
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301983 ANTI-HIST2H2AB (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178213 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178213 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178213 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_175065 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175065 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175065 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU218191 MISSION® esiRNA esiRNA targeting mouse Hist2h2ab mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175065 Rosetta Predictions human pricing
NM_001111341 Rosetta Predictions rat pricing
NM_178213 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175065 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039685 predicted 370
2 SASI_Hs01_00039686 predicted 222
3 SASI_Hs01_00039687 predicted 393
4 SASI_Hs01_00039688 predicted 335
5 SASI_Hs01_00039690 predicted 397
6 SASI_Hs01_00039693 predicted 164
7 SASI_Hs01_00039694 predicted 381
8 SASI_Hs02_00368968 predicted 164
9 SASI_Hs02_00368969 predicted 166
10 SASI_Hs02_00368970 predicted 364
11 SASI_Hs01_00039689 predicted 277
12 SASI_Hs01_00039691 predicted 265
13 SASI_Hs01_00039692 predicted 257
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111341 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251570 predicted 321
2 SASI_Rn02_00251571 predicted 336
3 SASI_Rn02_00251572 predicted 240
4 SASI_Rn02_00251573 predicted 334
5 SASI_Rn02_00251574 predicted 240
6 SASI_Rn02_00251575 predicted 235
7 SASI_Rn02_00251576 predicted 331
8 SASI_Rn02_00251577 predicted 195
9 SASI_Rn02_00251578 predicted 192
10 SASI_Rn02_00251579 predicted 264
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178213 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348622 predicted 336
2 SASI_Mm02_00348623 predicted 235
3 SASI_Mm02_00348624 predicted 243
4 SASI_Mm01_00135304 predicted 359
5 SASI_Mm01_00135305 predicted 129
6 SASI_Mm01_00135306 predicted 131
7 SASI_Mm01_00135307 predicted 130
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178213
HIST2H2AB MISSION shRNA Bacterial Glycerol Stock
histone cluster 2, H2ab
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178213.3-90s21c1
Sequence:CCGGTGTGCACCGGCTGCTGCGCAACTCGAGTTGCGCAGCAGCCGGTGCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178213.3-101s21c1
Sequence:CCGGTGCTGCGCAAGGGCAACTACGCTCGAGCGTAGTTGCCCTTGCGCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178213.3-168s21c1
Sequence:CCGGGGAGTACCTAACGGCCGAGATCTCGAGATCTCGGCCGTTAGGTACTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178213.3-39s21c1
Sequence:CCGGCAAGGCGAAGTCGCGGTCGTCCTCGAGGACGACCGCGACTTCGCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178213.3-222s21c1
Sequence:CCGGCAAGAAGACGCGCATCATCCCCTCGAGGGGATGATGCGCGTCTTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178213
HIST2H2AB MISSION shRNA shRNA Plasmid DNA
histone cluster 2, H2ab
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178213.3-90s21c1
Sequence:CCGGTGTGCACCGGCTGCTGCGCAACTCGAGTTGCGCAGCAGCCGGTGCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178213.3-101s21c1
Sequence:CCGGTGCTGCGCAAGGGCAACTACGCTCGAGCGTAGTTGCCCTTGCGCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178213.3-168s21c1
Sequence:CCGGGGAGTACCTAACGGCCGAGATCTCGAGATCTCGGCCGTTAGGTACTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178213.3-39s21c1
Sequence:CCGGCAAGGCGAAGTCGCGGTCGTCCTCGAGGACGACCGCGACTTCGCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178213.3-222s21c1
Sequence:CCGGCAAGAAGACGCGCATCATCCCCTCGAGGGGATGATGCGCGTCTTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178213
HIST2H2AB MISSION shRNA Lentiviral Transduction Particles
histone cluster 2, H2ab
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178213.3-90s21c1
Sequence:CCGGTGTGCACCGGCTGCTGCGCAACTCGAGTTGCGCAGCAGCCGGTGCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178213.3-101s21c1
Sequence:CCGGTGCTGCGCAAGGGCAACTACGCTCGAGCGTAGTTGCCCTTGCGCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178213.3-168s21c1
Sequence:CCGGGGAGTACCTAACGGCCGAGATCTCGAGATCTCGGCCGTTAGGTACTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178213.3-39s21c1
Sequence:CCGGCAAGGCGAAGTCGCGGTCGTCCTCGAGGACGACCGCGACTTCGCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178213.3-222s21c1
Sequence:CCGGCAAGAAGACGCGCATCATCCCCTCGAGGGGATGATGCGCGTCTTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175065
HIST2H2AB MISSION shRNA Bacterial Glycerol Stock
histone cluster 2, H2ab
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175065.2-271s1c1
Sequence:CCGGGACGAAGAGCTCAACAAGTTACTCGAGTAACTTGTTGAGCTCTTCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175065.2-261s1c1
Sequence:CCGGCGTGAGGAATGACGAAGAGCTCTCGAGAGCTCTTCGTCATTCCTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175065.2-177s1c1
Sequence:CCGGGACCGCGGAAATTCTGGAGCTCTCGAGAGCTCCAGAATTTCCGCGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175065.2-169s1c1
Sequence:CCGGGAGTACCTGACCGCGGAAATTCTCGAGAATTTCCGCGGTCAGGTACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175065.2-250s1c1
Sequence:CCGGCTGCAACTAGCCGTGAGGAATCTCGAGATTCCTCACGGCTAGTTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175065
HIST2H2AB MISSION shRNA shRNA Plasmid DNA
histone cluster 2, H2ab
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175065.2-271s1c1
Sequence:CCGGGACGAAGAGCTCAACAAGTTACTCGAGTAACTTGTTGAGCTCTTCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175065.2-261s1c1
Sequence:CCGGCGTGAGGAATGACGAAGAGCTCTCGAGAGCTCTTCGTCATTCCTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175065.2-177s1c1
Sequence:CCGGGACCGCGGAAATTCTGGAGCTCTCGAGAGCTCCAGAATTTCCGCGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175065.2-169s1c1
Sequence:CCGGGAGTACCTGACCGCGGAAATTCTCGAGAATTTCCGCGGTCAGGTACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175065.2-250s1c1
Sequence:CCGGCTGCAACTAGCCGTGAGGAATCTCGAGATTCCTCACGGCTAGTTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175065
HIST2H2AB MISSION shRNA Lentiviral Transduction Particles
histone cluster 2, H2ab
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175065.2-271s1c1
Sequence:CCGGGACGAAGAGCTCAACAAGTTACTCGAGTAACTTGTTGAGCTCTTCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175065.2-261s1c1
Sequence:CCGGCGTGAGGAATGACGAAGAGCTCTCGAGAGCTCTTCGTCATTCCTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175065.2-177s1c1
Sequence:CCGGGACCGCGGAAATTCTGGAGCTCTCGAGAGCTCCAGAATTTCCGCGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175065.2-169s1c1
Sequence:CCGGGAGTACCTGACCGCGGAAATTCTCGAGAATTTCCGCGGTCAGGTACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175065.2-250s1c1
Sequence:CCGGCTGCAACTAGCCGTGAGGAATCTCGAGATTCCTCACGGCTAGTTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)