EMAIL THIS PAGE TO A FRIEND

HIST2H2AC

histone cluster 2, H2ac

43 Gene Product Result for
Synonyms: H2A H2A-GL101 H2A/q H2AFQ
UniProtKB ID: Q16777, Q6DRA7, Q8IUE5
Gene ID:
Human(8338) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a member of the histone H2A family. [provided by RefSeq, Jul 2008]
Mouse(319176) histone cluster 2, H2ac
Rat(499675) histone cluster 2, H2ac
cow(513666) histone cluster 2, H2ac
dog(483174) histone cluster 2, H2ac
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003517 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003517 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003517 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175662 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175662 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175662 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003517 Rosetta Predictions human pricing
XM_001061850 Rosetta Predictions rat pricing
XM_574997 Rosetta Predictions rat pricing
NM_175662 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003517 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202887 predicted 360
2 SASI_Hs01_00202888 predicted 374
3 SASI_Hs01_00202889 predicted 336
4 SASI_Hs01_00202890 predicted 336
5 SASI_Hs01_00202891 predicted 332
6 SASI_Hs01_00202892 predicted 398
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061850 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00301499 predicted 368
2 SASI_Rn02_00301500 predicted 146
3 SASI_Rn02_00301501 predicted 210
4 SASI_Rn02_00301502 predicted 221
5 SASI_Rn02_00301503 predicted 373
6 SASI_Rn02_00301504 predicted 209
7 SASI_Rn02_00301505 predicted 141
8 SASI_Rn02_00301506 predicted 211
9 SASI_Rn02_00301507 predicted 142
10 SASI_Rn02_00301508 predicted 220
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574997 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00402890 predicted 369
2 SASI_Rn02_00402891 predicted 140
3 SASI_Rn02_00402892 predicted 214
4 SASI_Rn02_00402893 predicted 217
5 SASI_Rn02_00402894 predicted 371
6 SASI_Rn02_00402895 predicted 203
7 SASI_Rn02_00402896 predicted 143
8 SASI_Rn02_00402897 predicted 214
9 SASI_Rn02_00402898 predicted 138
10 SASI_Rn02_00402899 predicted 213
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175662 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117223 predicted 354
2 SASI_Mm01_00117224 predicted 124
3 SASI_Mm01_00117225 predicted 127
4 SASI_Mm01_00117226 predicted 129
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003517
HIST2H2AC MISSION shRNA Bacterial Glycerol Stock
histone cluster 2, H2ac
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003517.2-221s21c1
Sequence:CCGGACAAGAAGACGCGCATCATCCCTCGAGGGATGATGCGCGTCTTCTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003517.2-338s21c1
Sequence:CCGGAGGCCGTTCTGTTACCAAAGACTCGAGTCTTTGGTAACAGAACGGCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003517.2-234s21c1
Sequence:CCGGCATCATCCCTCGTCACCTCCACTCGAGTGGAGGTGACGAGGGATGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003517.2-168s1c1
Sequence:CCGGCGAGTACCTGACCGCCGAGATCTCGAGATCTCGGCGGTCAGGTACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003517.2-64s1c1
Sequence:CCGGGCTGGCCTCCAGTTCCCGGTACTCGAGTACCGGGAACTGGAGGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003517.2-273s1c1
Sequence:CCGGCGAGGAACTGAACAAGCTGCTCTCGAGAGCAGCTTGTTCAGTTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003517.2-91s1c1
Sequence:CCGGGTGCACCGCTTGCTGCGCAAACTCGAGTTTGCGCAGCAAGCGGTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003517.2-267s1c1
Sequence:CCGGCAACGACGAGGAACTGAACAACTCGAGTTGTTCAGTTCCTCGTCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003517
HIST2H2AC MISSION shRNA shRNA Plasmid DNA
histone cluster 2, H2ac
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003517.2-221s21c1
Sequence:CCGGACAAGAAGACGCGCATCATCCCTCGAGGGATGATGCGCGTCTTCTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003517.2-338s21c1
Sequence:CCGGAGGCCGTTCTGTTACCAAAGACTCGAGTCTTTGGTAACAGAACGGCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003517.2-234s21c1
Sequence:CCGGCATCATCCCTCGTCACCTCCACTCGAGTGGAGGTGACGAGGGATGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003517.2-168s1c1
Sequence:CCGGCGAGTACCTGACCGCCGAGATCTCGAGATCTCGGCGGTCAGGTACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003517.2-64s1c1
Sequence:CCGGGCTGGCCTCCAGTTCCCGGTACTCGAGTACCGGGAACTGGAGGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003517.2-273s1c1
Sequence:CCGGCGAGGAACTGAACAAGCTGCTCTCGAGAGCAGCTTGTTCAGTTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003517.2-91s1c1
Sequence:CCGGGTGCACCGCTTGCTGCGCAAACTCGAGTTTGCGCAGCAAGCGGTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003517.2-267s1c1
Sequence:CCGGCAACGACGAGGAACTGAACAACTCGAGTTGTTCAGTTCCTCGTCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003517
HIST2H2AC MISSION shRNA Lentiviral Transduction Particles
histone cluster 2, H2ac
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003517.2-221s21c1
Sequence:CCGGACAAGAAGACGCGCATCATCCCTCGAGGGATGATGCGCGTCTTCTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003517.2-338s21c1
Sequence:CCGGAGGCCGTTCTGTTACCAAAGACTCGAGTCTTTGGTAACAGAACGGCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003517.2-234s21c1
Sequence:CCGGCATCATCCCTCGTCACCTCCACTCGAGTGGAGGTGACGAGGGATGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003517.2-168s1c1
Sequence:CCGGCGAGTACCTGACCGCCGAGATCTCGAGATCTCGGCGGTCAGGTACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003517.2-64s1c1
Sequence:CCGGGCTGGCCTCCAGTTCCCGGTACTCGAGTACCGGGAACTGGAGGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003517.2-273s1c1
Sequence:CCGGCGAGGAACTGAACAAGCTGCTCTCGAGAGCAGCTTGTTCAGTTCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003517.2-91s1c1
Sequence:CCGGGTGCACCGCTTGCTGCGCAAACTCGAGTTTGCGCAGCAAGCGGTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003517.2-267s1c1
Sequence:CCGGCAACGACGAGGAACTGAACAACTCGAGTTGTTCAGTTCCTCGTCGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175662
HIST2H2AC MISSION shRNA Bacterial Glycerol Stock
histone cluster 2, H2ac
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175662.1-167s1c1
Sequence:CCGGTGGAGTACCTAACGGCCGAGACTCGAGTCTCGGCCGTTAGGTACTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175662.1-105s1c1
Sequence:CCGGGCGCAAGGGCAACTACGCGGACTCGAGTCCGCGTAGTTGCCCTTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175662.1-218s1c1
Sequence:CCGGACAACAAGAAGACGCGCATCACTCGAGTGATGCGCGTCTTCTTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175662.1-165s1c1
Sequence:CCGGGCTGGAGTACCTAACGGCCGACTCGAGTCGGCCGTTAGGTACTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175662.1-37s1c1
Sequence:CCGGGCCAAGGCCAAGTCGCGGTCTCTCGAGAGACCGCGACTTGGCCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175662
HIST2H2AC MISSION shRNA shRNA Plasmid DNA
histone cluster 2, H2ac
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175662.1-167s1c1
Sequence:CCGGTGGAGTACCTAACGGCCGAGACTCGAGTCTCGGCCGTTAGGTACTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175662.1-105s1c1
Sequence:CCGGGCGCAAGGGCAACTACGCGGACTCGAGTCCGCGTAGTTGCCCTTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175662.1-218s1c1
Sequence:CCGGACAACAAGAAGACGCGCATCACTCGAGTGATGCGCGTCTTCTTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175662.1-165s1c1
Sequence:CCGGGCTGGAGTACCTAACGGCCGACTCGAGTCGGCCGTTAGGTACTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175662.1-37s1c1
Sequence:CCGGGCCAAGGCCAAGTCGCGGTCTCTCGAGAGACCGCGACTTGGCCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175662
HIST2H2AC MISSION shRNA Lentiviral Transduction Particles
histone cluster 2, H2ac
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175662.1-167s1c1
Sequence:CCGGTGGAGTACCTAACGGCCGAGACTCGAGTCTCGGCCGTTAGGTACTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175662.1-105s1c1
Sequence:CCGGGCGCAAGGGCAACTACGCGGACTCGAGTCCGCGTAGTTGCCCTTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175662.1-218s1c1
Sequence:CCGGACAACAAGAAGACGCGCATCACTCGAGTGATGCGCGTCTTCTTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175662.1-165s1c1
Sequence:CCGGGCTGGAGTACCTAACGGCCGACTCGAGTCGGCCGTTAGGTACTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175662.1-37s1c1
Sequence:CCGGGCCAAGGCCAAGTCGCGGTCTCTCGAGAGACCGCGACTTGGCCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)