EMAIL THIS PAGE TO A FRIEND

HIST2H2BF

histone cluster 2, H2bf

15 Gene Product Result for
UniProtKB ID: Q5QNW6, A8K0U9, B4DLA9
Gene ID:
Human(440689) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. This structure consists of approximately 146 bp of DNA wrapped around a nucleosome, an octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene encodes a member of the histone H2B family and is found in a histone cluster on chromosome 1. [provided by RefSeq, Jan 2013]
cow(615091) histone cluster 2, H2bf
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001024599 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001024599 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001024599 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU129051 MISSION® esiRNA esiRNA human HIST2H2BF (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024599 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024599 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197500 predicted 408
2 SASI_Hs01_00197501 predicted 420
3 SASI_Hs01_00197502 predicted 482
4 SASI_Hs01_00197503 predicted 554
5 SASI_Hs01_00197504 predicted 534
6 SASI_Hs01_00197505 predicted 641
7 SASI_Hs01_00197506 predicted 468
8 SASI_Hs01_00197507 predicted 566
9 SASI_Hs01_00197508 predicted 627
10 SASI_Hs01_00197509 predicted 502
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024599
HIST2H2BF MISSION shRNA Bacterial Glycerol Stock
histone cluster 2, H2bf
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106870    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024599.1-473s1c1
Sequence:CCGGGCCACTTCAGTAATCGAGAAACTCGAGTTTCTCGATTACTGAAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024599.1-64s1c1
Sequence:CCGGGCTCCCAAGAAGGGCTCCAAACTCGAGTTTGGAGCCCTTCTTGGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024599.1-138s1c1
Sequence:CCGGCAAGGAGAGCTACTCCGTTTACTCGAGTAAACGGAGTAGCTCTCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024599.1-90s1c1
Sequence:CCGGTGTTACGAAAGTGCAGAAGAACTCGAGTTCTTCTGCACTTTCGTAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024599.1-396s1c1
Sequence:CCGGCAAGTACACCAGCTCGAAGTACTCGAGTACTTCGAGCTGGTGTACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024599
HIST2H2BF MISSION shRNA shRNA Plasmid DNA
histone cluster 2, H2bf
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106870    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024599.1-473s1c1
Sequence:CCGGGCCACTTCAGTAATCGAGAAACTCGAGTTTCTCGATTACTGAAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024599.1-64s1c1
Sequence:CCGGGCTCCCAAGAAGGGCTCCAAACTCGAGTTTGGAGCCCTTCTTGGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024599.1-138s1c1
Sequence:CCGGCAAGGAGAGCTACTCCGTTTACTCGAGTAAACGGAGTAGCTCTCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024599.1-90s1c1
Sequence:CCGGTGTTACGAAAGTGCAGAAGAACTCGAGTTCTTCTGCACTTTCGTAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024599.1-396s1c1
Sequence:CCGGCAAGTACACCAGCTCGAAGTACTCGAGTACTTCGAGCTGGTGTACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024599
HIST2H2BF MISSION shRNA Lentiviral Transduction Particles
histone cluster 2, H2bf
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106870    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024599.1-473s1c1
Sequence:CCGGGCCACTTCAGTAATCGAGAAACTCGAGTTTCTCGATTACTGAAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024599.1-64s1c1
Sequence:CCGGGCTCCCAAGAAGGGCTCCAAACTCGAGTTTGGAGCCCTTCTTGGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024599.1-138s1c1
Sequence:CCGGCAAGGAGAGCTACTCCGTTTACTCGAGTAAACGGAGTAGCTCTCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024599.1-90s1c1
Sequence:CCGGTGTTACGAAAGTGCAGAAGAACTCGAGTTCTTCTGCACTTTCGTAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024599.1-396s1c1
Sequence:CCGGCAAGTACACCAGCTCGAAGTACTCGAGTACTTCGAGCTGGTGTACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)