EMAIL THIS PAGE TO A FRIEND

HIST2H3A

histone cluster 2, H3a

19 Gene Product Result for
Synonyms: H3/n H3/o
Species: Human HIST2H3A(333932)
UniProtKB ID: Q71DI3, A2BDF6, A6NFS4, Q6B053
Gene ID:
Human(333932) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. This structure consists of approximately 146 bp of DNA wrapped around a nucleosome, an octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a member of the histone H3 family. Transcripts from this gene lack polyA tails; instead, they contain a palindromic termination element. This gene is found in a histone cluster on chromosome 1. This gene is one of four histone genes in the cluster that are duplicated; this record represents the centromeric copy. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
H9161 Anti-acetyl- & phospho-Histone H3 (Ac-Lys9, pSer10) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution frog, bovine, human, mouse, Caenorhabditis elegans, Drosophila, rat, chicken
immunofluorescence, microarray, western blot pricing
H9286 Anti-acetyl-Histone H3 (Ac-Lys9) antibody produced in rabbit 2-2.5 mg/mL, affinity isolated antibody, buffered aqueous solution Drosophila, human, bovine, frog, chicken, Caenorhabditis elegans, rat, mouse
immunofluorescence, microarray, western blot pricing
H0913 Anti-acetyl-Histone H3 (Ac-Lys9) antibody, Mouse monoclonal clone AH3-120, purified from hybridoma cell culture human, mouse, bovine, frog, chicken, rat, Caenorhabditis elegans, Drosophila
ELISA, immunocytochemistry, microarray, western blot pricing
D5692 Anti-dimethyl-Histone H3 (diMe-Lys4) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution Caenorhabditis elegans, Arabidopsis thaliana, Drosophila, human, bovine, frog, rat, chicken, mouse
ChIP, microarray, western blot pricing
D5567 Anti-dimethyl-Histone H3 (diMe-Lys9) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution Arabidopsis thaliana, Drosophila, Caenorhabditis elegans, bovine, human, chicken, frog, rat, mouse
ChIP, microarray, western blot pricing
H0164 Anti-Histone H3 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, plant, human, Drosophila, rat, chicken, Xenopus
immunofluorescence, western blot pricing
M4819 Anti-methyl-Histone H3 (Me-Lys4) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution chicken, Caenorhabditis elegans, Drosophila, bovine, mouse, human, frog, Arabidopsis thaliana, rat
western blot pricing
H7162 Anti-methyl-Histone H3 (Me-Lys9) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution Caenorhabditis elegans, mouse, rat, bovine, chicken, frog, Drosophila, human
microarray, western blot pricing
H0412 Anti-phospho-Histone H3 (pSer10) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution frog, human, mouse, Drosophila, rat, Caenorhabditis elegans, bovine, chicken
immunofluorescence, microarray, western blot pricing
SAB5100007 Imprint®ChIP-Validated Anti-Acetyl-Histone H3 (Ac-Lys9) (H3K9ac) antibody produced in rabbit affinity isolated antibody human
ChIP, western blot pricing
SAB5100009 Imprint ® ChiP-Validated Anti-methyl-Histone H3 (Me-Lys4) (H3K4me1) antibody produced in rabbit affinity isolated antibody chicken, frog, mouse, bovine, human
ChIP, western blot pricing
SAB5100008 Imprint® ChIP-Validated Anti-methyl-Histone H3 (Me-Lys9) (H3K9me1) affinity isolated antibody human
ChIP, western blot pricing
H0788 Monoclonal Anti-acetyl- & phospho-Histone H3 (Ac-Lys9, pSer10) antibody produced in mouse ~2 mg/mL, clone APH3-64, purified immunoglobulin, buffered aqueous solution frog, rat, Drosophila, Caenorhabditis elegans, human, mouse, bovine, chicken
ELISA, immunoprecipitation (IP), microarray, western blot pricing
H9908 Monoclonal Anti-phospho-Histone H3 (pSer28) antibody produced in rat ~0.5 mg/mL, clone HTA28, purified immunoglobulin, buffered aqueous solution human, bovine, hamster, mouse
flow cytometry, immunocytochemistry, microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005464 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005464 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005464 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005464 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005464 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00304925 predicted 457
2 SASI_Hs02_00304926 predicted 435
3 SASI_Hs02_00304927 predicted 461
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005464
HIST2H3A MISSION shRNA Bacterial Glycerol Stock
histone cluster 2, H3a
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000281408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005464.2-256s21c1
Sequence:CCGGGAGATCGCGCAGGACTTTAAGCTCGAGCTTAAAGTCCTGCGCGATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005464.2-271s21c1
Sequence:CCGGTTTAAGACGGACCTGCGCTTCCTCGAGGAAGCGCAGGTCCGTCTTAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005464.2-171s21c1
Sequence:CCGGCACCGTAGCCCTGCGGGAGATCTCGAGATCTCCCGCAGGGCTACGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005464.2-240s21c1
Sequence:CCGGCCAGCGGCTGGTACGCGAGATCTCGAGATCTCGCGTACCAGCCGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005464
HIST2H3A MISSION shRNA shRNA Plasmid DNA
histone cluster 2, H3a
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000281408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005464.2-256s21c1
Sequence:CCGGGAGATCGCGCAGGACTTTAAGCTCGAGCTTAAAGTCCTGCGCGATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005464.2-271s21c1
Sequence:CCGGTTTAAGACGGACCTGCGCTTCCTCGAGGAAGCGCAGGTCCGTCTTAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005464.2-171s21c1
Sequence:CCGGCACCGTAGCCCTGCGGGAGATCTCGAGATCTCCCGCAGGGCTACGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005464.2-240s21c1
Sequence:CCGGCCAGCGGCTGGTACGCGAGATCTCGAGATCTCGCGTACCAGCCGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005464
HIST2H3A MISSION shRNA Lentiviral Transduction Particles
histone cluster 2, H3a
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000281408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005464.2-256s21c1
Sequence:CCGGGAGATCGCGCAGGACTTTAAGCTCGAGCTTAAAGTCCTGCGCGATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005464.2-271s21c1
Sequence:CCGGTTTAAGACGGACCTGCGCTTCCTCGAGGAAGCGCAGGTCCGTCTTAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005464.2-171s21c1
Sequence:CCGGCACCGTAGCCCTGCGGGAGATCTCGAGATCTCCCGCAGGGCTACGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005464.2-240s21c1
Sequence:CCGGCCAGCGGCTGGTACGCGAGATCTCGAGATCTCGCGTACCAGCCGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)