EMAIL THIS PAGE TO A FRIEND

Hist2h3b

15 Gene Product Result for
Species: Mouse Hist2h3b(319154)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
H9161 Anti-acetyl- & phospho-Histone H3 (Ac-Lys9, pSer10) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution frog, bovine, human, mouse, Caenorhabditis elegans, Drosophila, rat, chicken
immunofluorescence, microarray, western blot pricing
H9286 Anti-acetyl-Histone H3 (Ac-Lys9) antibody produced in rabbit 2-2.5 mg/mL, affinity isolated antibody, buffered aqueous solution Drosophila, human, bovine, frog, chicken, Caenorhabditis elegans, rat, mouse
immunofluorescence, microarray, western blot pricing
H0913 Anti-acetyl-Histone H3 (Ac-Lys9) antibody, Mouse monoclonal clone AH3-120, purified from hybridoma cell culture human, mouse, bovine, frog, chicken, rat, Caenorhabditis elegans, Drosophila
ELISA, immunocytochemistry, microarray, western blot pricing
D5692 Anti-dimethyl-Histone H3 (diMe-Lys4) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution Caenorhabditis elegans, Arabidopsis thaliana, Drosophila, human, bovine, frog, rat, chicken, mouse
ChIP, microarray, western blot pricing
D5567 Anti-dimethyl-Histone H3 (diMe-Lys9) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution Arabidopsis thaliana, Drosophila, Caenorhabditis elegans, bovine, human, chicken, frog, rat, mouse
ChIP, microarray, western blot pricing
H0164 Anti-Histone H3 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, plant, human, Drosophila, rat, chicken, Xenopus
immunofluorescence, western blot pricing
M4819 Anti-methyl-Histone H3 (Me-Lys4) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution chicken, Caenorhabditis elegans, Drosophila, bovine, mouse, human, frog, Arabidopsis thaliana, rat
western blot pricing
H7162 Anti-methyl-Histone H3 (Me-Lys9) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution Caenorhabditis elegans, mouse, rat, bovine, chicken, frog, Drosophila, human
microarray, western blot pricing
H0412 Anti-phospho-Histone H3 (pSer10) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution frog, human, mouse, Drosophila, rat, Caenorhabditis elegans, bovine, chicken
immunofluorescence, microarray, western blot pricing
SAB5100009 Imprint ® ChiP-Validated Anti-methyl-Histone H3 (Me-Lys4) (H3K4me1) antibody produced in rabbit affinity isolated antibody chicken, frog, mouse, bovine, human
ChIP, western blot pricing
H0788 Monoclonal Anti-acetyl- & phospho-Histone H3 (Ac-Lys9, pSer10) antibody produced in mouse ~2 mg/mL, clone APH3-64, purified immunoglobulin, buffered aqueous solution frog, rat, Drosophila, Caenorhabditis elegans, human, mouse, bovine, chicken
ELISA, immunoprecipitation (IP), microarray, western blot pricing
H9908 Monoclonal Anti-phospho-Histone H3 (pSer28) antibody produced in rat ~0.5 mg/mL, clone HTA28, purified immunoglobulin, buffered aqueous solution human, bovine, hamster, mouse
flow cytometry, immunocytochemistry, microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178215 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178215 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178215 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178215 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178215 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174598 predicted 334
2 SASI_Mm01_00174599 predicted 329
3 SASI_Mm01_00174600 predicted 338
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178215
Hist2h3b MISSION shRNA Bacterial Glycerol Stock
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178215.1-218s21c1
Sequence:CCGGGCGAGATCGCGCAGGACTTCACTCGAGTGAAGTCCTGCGCGATCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178215.1-229s21c1
Sequence:CCGGCAGGACTTCAAGACGGACCTGCTCGAGCAGGTCCGTCTTGAAGTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178215.1-170s21c1
Sequence:CCGGAGTCGACCGAGCTGCTGATCCCTCGAGGGATCAGCAGCTCGGTCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178215.1-188s21c1
Sequence:CCGGTCCGCAAGCTGCCGTTCCAGCCTCGAGGCTGGAACGGCAGCTTGCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178215.1-106s21c1
Sequence:CCGGGTGAAGAAGCCGCACCGCTACCTCGAGGTAGCGGTGCGGCTTCTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178215
Hist2h3b MISSION shRNA shRNA Plasmid DNA
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178215.1-218s21c1
Sequence:CCGGGCGAGATCGCGCAGGACTTCACTCGAGTGAAGTCCTGCGCGATCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178215.1-229s21c1
Sequence:CCGGCAGGACTTCAAGACGGACCTGCTCGAGCAGGTCCGTCTTGAAGTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178215.1-170s21c1
Sequence:CCGGAGTCGACCGAGCTGCTGATCCCTCGAGGGATCAGCAGCTCGGTCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178215.1-188s21c1
Sequence:CCGGTCCGCAAGCTGCCGTTCCAGCCTCGAGGCTGGAACGGCAGCTTGCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178215.1-106s21c1
Sequence:CCGGGTGAAGAAGCCGCACCGCTACCTCGAGGTAGCGGTGCGGCTTCTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178215
Hist2h3b MISSION shRNA Lentiviral Transduction Particles
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178215.1-218s21c1
Sequence:CCGGGCGAGATCGCGCAGGACTTCACTCGAGTGAAGTCCTGCGCGATCTCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178215.1-229s21c1
Sequence:CCGGCAGGACTTCAAGACGGACCTGCTCGAGCAGGTCCGTCTTGAAGTCCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178215.1-170s21c1
Sequence:CCGGAGTCGACCGAGCTGCTGATCCCTCGAGGGATCAGCAGCTCGGTCGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178215.1-188s21c1
Sequence:CCGGTCCGCAAGCTGCCGTTCCAGCCTCGAGGCTGGAACGGCAGCTTGCGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178215.1-106s21c1
Sequence:CCGGGTGAAGAAGCCGCACCGCTACCTCGAGGTAGCGGTGCGGCTTCTTCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)