EMAIL THIS PAGE TO A FRIEND

Hist2h3c1

33 Gene Product Result for
Species: Mouse Hist2h3c1(15077)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
H9161 Anti-acetyl- & phospho-Histone H3 (Ac-Lys9, pSer10) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution frog, bovine, human, mouse, Caenorhabditis elegans, Drosophila, rat, chicken
immunofluorescence, microarray, western blot pricing
H9286 Anti-acetyl-Histone H3 (Ac-Lys9) antibody produced in rabbit 2-2.5 mg/mL, affinity isolated antibody, buffered aqueous solution Drosophila, human, bovine, frog, chicken, Caenorhabditis elegans, rat, mouse
immunofluorescence, microarray, western blot pricing
H0913 Anti-acetyl-Histone H3 (Ac-Lys9) antibody, Mouse monoclonal clone AH3-120, purified from hybridoma cell culture human, mouse, bovine, frog, chicken, rat, Caenorhabditis elegans, Drosophila
ELISA, immunocytochemistry, microarray, western blot pricing
D5692 Anti-dimethyl-Histone H3 (diMe-Lys4) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution Caenorhabditis elegans, Arabidopsis thaliana, Drosophila, human, bovine, frog, rat, chicken, mouse
ChIP, microarray, western blot pricing
D5567 Anti-dimethyl-Histone H3 (diMe-Lys9) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution Arabidopsis thaliana, Drosophila, Caenorhabditis elegans, bovine, human, chicken, frog, rat, mouse
ChIP, microarray, western blot pricing
H0164 Anti-Histone H3 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, plant, human, Drosophila, rat, chicken, Xenopus
immunofluorescence, western blot pricing
M4819 Anti-methyl-Histone H3 (Me-Lys4) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution chicken, Caenorhabditis elegans, Drosophila, bovine, mouse, human, frog, Arabidopsis thaliana, rat
western blot pricing
H7162 Anti-methyl-Histone H3 (Me-Lys9) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution Caenorhabditis elegans, mouse, rat, bovine, chicken, frog, Drosophila, human
microarray, western blot pricing
H0412 Anti-phospho-Histone H3 (pSer10) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution frog, human, mouse, Drosophila, rat, Caenorhabditis elegans, bovine, chicken
immunofluorescence, microarray, western blot pricing
SAB5100009 Imprint ® ChiP-Validated Anti-methyl-Histone H3 (Me-Lys4) (H3K4me1) antibody produced in rabbit affinity isolated antibody chicken, frog, mouse, bovine, human
ChIP, western blot pricing
H0788 Monoclonal Anti-acetyl- & phospho-Histone H3 (Ac-Lys9, pSer10) antibody produced in mouse ~2 mg/mL, clone APH3-64, purified immunoglobulin, buffered aqueous solution frog, rat, Drosophila, Caenorhabditis elegans, human, mouse, bovine, chicken
ELISA, immunoprecipitation (IP), microarray, western blot pricing
H9908 Monoclonal Anti-phospho-Histone H3 (pSer28) antibody produced in rat ~0.5 mg/mL, clone HTA28, purified immunoglobulin, buffered aqueous solution human, bovine, hamster, mouse
flow cytometry, immunocytochemistry, microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178216 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178216 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178216 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU093261 MISSION® esiRNA esiRNA targeting mouse Hist1h3f (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019469 Rosetta Predictions mouse pricing
NM_178216 Rosetta Predictions mouse pricing
XM_886396 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019469 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087948 predicted 339
2 SASI_Mm01_00087949 predicted 334
3 SASI_Mm01_00087951 predicted 335
4 SASI_Mm01_00087950 predicted 328
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178216 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194869 predicted 471
2 SASI_Mm01_00194870 predicted 96
3 SASI_Mm01_00194871 predicted 11
4 SASI_Mm01_00194872 predicted 463
5 SASI_Mm01_00194873 predicted 102
6 SASI_Mm01_00194874 predicted 476
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_886396 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00253628 predicted 1914
2 SASI_Mm01_00253629 predicted 1789
3 SASI_Mm01_00253630 predicted 1295
4 SASI_Mm01_00253631 predicted 2133
5 SASI_Mm01_00253632 predicted 1990
6 SASI_Mm01_00253633 predicted 2243
7 SASI_Mm01_00253634 predicted 1906
8 SASI_Mm01_00253635 predicted 2040
9 SASI_Mm01_00253636 predicted 2118
10 SASI_Mm01_00253637 predicted 1904
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178216
Hist2h3c1 MISSION shRNA Bacterial Glycerol Stock
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178216.1-111s1c1
Sequence:CCGGCGTTTGGGTGTCTTCCGTCTTCTCGAGAAGACGGAAGACACCCAAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178216.1-240s1c1
Sequence:CCGGCGTGAAGAAGCCGCACCGCTACTCGAGTAGCGGTGCGGCTTCTTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178216.1-104s1c1
Sequence:CCGGTGCTCCTCGTTTGGGTGTCTTCTCGAGAAGACACCCAAACGAGGAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178216.1-146s1c1
Sequence:CCGGCGAAGCAGACTGCCCGCAAGTCTCGAGACTTGCGGGCAGTCTGCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178216.1-363s1c1
Sequence:CCGGGCAGGACTTCAAGACGGACCTCTCGAGAGGTCCGTCTTGAAGTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178216
Hist2h3c1 MISSION shRNA shRNA Plasmid DNA
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178216.1-111s1c1
Sequence:CCGGCGTTTGGGTGTCTTCCGTCTTCTCGAGAAGACGGAAGACACCCAAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178216.1-240s1c1
Sequence:CCGGCGTGAAGAAGCCGCACCGCTACTCGAGTAGCGGTGCGGCTTCTTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178216.1-104s1c1
Sequence:CCGGTGCTCCTCGTTTGGGTGTCTTCTCGAGAAGACACCCAAACGAGGAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178216.1-146s1c1
Sequence:CCGGCGAAGCAGACTGCCCGCAAGTCTCGAGACTTGCGGGCAGTCTGCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178216.1-363s1c1
Sequence:CCGGGCAGGACTTCAAGACGGACCTCTCGAGAGGTCCGTCTTGAAGTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178216
Hist2h3c1 MISSION shRNA Lentiviral Transduction Particles
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178216.1-111s1c1
Sequence:CCGGCGTTTGGGTGTCTTCCGTCTTCTCGAGAAGACGGAAGACACCCAAACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178216.1-240s1c1
Sequence:CCGGCGTGAAGAAGCCGCACCGCTACTCGAGTAGCGGTGCGGCTTCTTCACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178216.1-104s1c1
Sequence:CCGGTGCTCCTCGTTTGGGTGTCTTCTCGAGAAGACACCCAAACGAGGAGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178216.1-146s1c1
Sequence:CCGGCGAAGCAGACTGCCCGCAAGTCTCGAGACTTGCGGGCAGTCTGCTTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178216.1-363s1c1
Sequence:CCGGGCAGGACTTCAAGACGGACCTCTCGAGAGGTCCGTCTTGAAGTCCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)