EMAIL THIS PAGE TO A FRIEND

Hist2h3c2

32 Gene Product Result for
Gene ID:
Rat(310678) histone cluster 2, H3c2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
H9161 Anti-acetyl- & phospho-Histone H3 (Ac-Lys9, pSer10) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution frog, bovine, human, mouse, Caenorhabditis elegans, Drosophila, rat, chicken
immunofluorescence, microarray, western blot pricing
H9286 Anti-acetyl-Histone H3 (Ac-Lys9) antibody produced in rabbit 2-2.5 mg/mL, affinity isolated antibody, buffered aqueous solution Drosophila, human, bovine, frog, chicken, Caenorhabditis elegans, rat, mouse
immunofluorescence, microarray, western blot pricing
H0913 Anti-acetyl-Histone H3 (Ac-Lys9) antibody, Mouse monoclonal clone AH3-120, purified from hybridoma cell culture human, mouse, bovine, frog, chicken, rat, Caenorhabditis elegans, Drosophila
ELISA, immunocytochemistry, microarray, western blot pricing
D5692 Anti-dimethyl-Histone H3 (diMe-Lys4) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution Caenorhabditis elegans, Arabidopsis thaliana, Drosophila, human, bovine, frog, rat, chicken, mouse
ChIP, microarray, western blot pricing
D5567 Anti-dimethyl-Histone H3 (diMe-Lys9) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution Arabidopsis thaliana, Drosophila, Caenorhabditis elegans, bovine, human, chicken, frog, rat, mouse
ChIP, microarray, western blot pricing
H0164 Anti-Histone H3 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, plant, human, Drosophila, rat, chicken, Xenopus
immunofluorescence, western blot pricing
M4819 Anti-methyl-Histone H3 (Me-Lys4) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution chicken, Caenorhabditis elegans, Drosophila, bovine, mouse, human, frog, Arabidopsis thaliana, rat
western blot pricing
H7162 Anti-methyl-Histone H3 (Me-Lys9) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution Caenorhabditis elegans, mouse, rat, bovine, chicken, frog, Drosophila, human
microarray, western blot pricing
H0412 Anti-phospho-Histone H3 (pSer10) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution frog, human, mouse, Drosophila, rat, Caenorhabditis elegans, bovine, chicken
immunofluorescence, microarray, western blot pricing
SAB5100009 Imprint ® ChiP-Validated Anti-methyl-Histone H3 (Me-Lys4) (H3K4me1) antibody produced in rabbit affinity isolated antibody chicken, frog, mouse, bovine, human
ChIP, western blot pricing
H0788 Monoclonal Anti-acetyl- & phospho-Histone H3 (Ac-Lys9, pSer10) antibody produced in mouse ~2 mg/mL, clone APH3-64, purified immunoglobulin, buffered aqueous solution frog, rat, Drosophila, Caenorhabditis elegans, human, mouse, bovine, chicken
ELISA, immunoprecipitation (IP), microarray, western blot pricing
H9908 Monoclonal Anti-phospho-Histone H3 (pSer28) antibody produced in rat ~0.5 mg/mL, clone HTA28, purified immunoglobulin, buffered aqueous solution human, bovine, hamster, mouse
flow cytometry, immunocytochemistry, microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_054045 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_054045 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_054045 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001107698 Rosetta Predictions rat pricing
NM_054045 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107698 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231395 predicted 334
2 SASI_Rn02_00231396 predicted 125
3 SASI_Rn02_00231397 predicted 325
4 SASI_Rn02_00231398 predicted 131
5 SASI_Rn02_00231399 predicted 374
6 SASI_Rn02_00231400 predicted 294
7 SASI_Rn02_00231401 predicted 339
8 SASI_Rn02_00231402 predicted 90
9 SASI_Rn02_00231403 predicted 93
10 SASI_Rn02_00231404 predicted 63
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054045 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136123 predicted 653
2 SASI_Mm01_00136124 predicted 763
3 SASI_Mm01_00136125 predicted 780
4 SASI_Mm01_00136126 predicted 772
5 SASI_Mm01_00136127 predicted 731
6 SASI_Mm01_00136128 predicted 682
7 SASI_Mm01_00136129 predicted 722
8 SASI_Mm01_00136130 predicted 778
9 SASI_Mm01_00136131 predicted 721
10 SASI_Mm01_00136132 predicted 649
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_054045
VALIDATED
Hist2h3c2 MISSION shRNA Bacterial Glycerol Stock
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092883    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054045.2-811s1c1
Sequence:CCGGGCGGTCTTATTCAGACTCCTACTCGAGTAGGAGTCTGAATAAGACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054045.2-537s1c1
Sequence:CCGGCGTCACCATCATGCCCAAGGACTCGAGTCCTTGGGCATGATGGTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054045.2-546s1c1
Sequence:CCGGCATGCCCAAGGACATCCAGTTCTCGAGAACTGGATGTCCTTGGGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348704    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054045.2-715s21c1
Sequence:CCGGCTAGGTTGGTATCTGACTTATCTCGAGATAAGTCAGATACCAACCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054045.2-514s1c1
Sequence:CCGGCTGTGCGCCATCCACGCCAAACTCGAGTTTGGCGTGGATGGCGCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054045.2-525s1c1
Sequence:CCGGCCACGCCAAACGCGTCACCATCTCGAGATGGTGACGCGTTTGGCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348703    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054045.2-681s21c1
Sequence:CCGGGAGCTTTGTCCGCACATTATCCTCGAGGATAATGTGCGGACAAAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054045.2-525s21c1
Sequence:CCGGCCACGCCAAACGCGTCACCATCTCGAGATGGTGACGCGTTTGGCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348705    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054045.2-900s21c1
Sequence:CCGGGCTTGGTGGATACTATGTAATCTCGAGATTACATAGTATCCACCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348706    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054045.2-800s21c1
Sequence:CCGGTAACGTTAATTGCGGTCTTATCTCGAGATAAGACCGCAATTAACGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_054045
VALIDATED
Hist2h3c2 MISSION shRNA shRNA Plasmid DNA
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092883    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054045.2-811s1c1
Sequence:CCGGGCGGTCTTATTCAGACTCCTACTCGAGTAGGAGTCTGAATAAGACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054045.2-537s1c1
Sequence:CCGGCGTCACCATCATGCCCAAGGACTCGAGTCCTTGGGCATGATGGTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054045.2-546s1c1
Sequence:CCGGCATGCCCAAGGACATCCAGTTCTCGAGAACTGGATGTCCTTGGGCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348704    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054045.2-715s21c1
Sequence:CCGGCTAGGTTGGTATCTGACTTATCTCGAGATAAGTCAGATACCAACCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054045.2-514s1c1
Sequence:CCGGCTGTGCGCCATCCACGCCAAACTCGAGTTTGGCGTGGATGGCGCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054045.2-525s1c1
Sequence:CCGGCCACGCCAAACGCGTCACCATCTCGAGATGGTGACGCGTTTGGCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348703    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054045.2-681s21c1
Sequence:CCGGGAGCTTTGTCCGCACATTATCCTCGAGGATAATGTGCGGACAAAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054045.2-525s21c1
Sequence:CCGGCCACGCCAAACGCGTCACCATCTCGAGATGGTGACGCGTTTGGCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348705    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054045.2-900s21c1
Sequence:CCGGGCTTGGTGGATACTATGTAATCTCGAGATTACATAGTATCCACCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348706    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054045.2-800s21c1
Sequence:CCGGTAACGTTAATTGCGGTCTTATCTCGAGATAAGACCGCAATTAACGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_054045
VALIDATED
Hist2h3c2 MISSION shRNA Lentiviral Transduction Particles
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092883    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054045.2-811s1c1
Sequence:CCGGGCGGTCTTATTCAGACTCCTACTCGAGTAGGAGTCTGAATAAGACCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054045.2-537s1c1
Sequence:CCGGCGTCACCATCATGCCCAAGGACTCGAGTCCTTGGGCATGATGGTGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054045.2-546s1c1
Sequence:CCGGCATGCCCAAGGACATCCAGTTCTCGAGAACTGGATGTCCTTGGGCATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348704    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054045.2-715s21c1
Sequence:CCGGCTAGGTTGGTATCTGACTTATCTCGAGATAAGTCAGATACCAACCTAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054045.2-514s1c1
Sequence:CCGGCTGTGCGCCATCCACGCCAAACTCGAGTTTGGCGTGGATGGCGCACAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054045.2-525s1c1
Sequence:CCGGCCACGCCAAACGCGTCACCATCTCGAGATGGTGACGCGTTTGGCGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348703    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054045.2-681s21c1
Sequence:CCGGGAGCTTTGTCCGCACATTATCCTCGAGGATAATGTGCGGACAAAGCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054045.2-525s21c1
Sequence:CCGGCCACGCCAAACGCGTCACCATCTCGAGATGGTGACGCGTTTGGCGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348705    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054045.2-900s21c1
Sequence:CCGGGCTTGGTGGATACTATGTAATCTCGAGATTACATAGTATCCACCAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348706    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054045.2-800s21c1
Sequence:CCGGTAACGTTAATTGCGGTCTTATCTCGAGATAAGACCGCAATTAACGTTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)