EMAIL THIS PAGE TO A FRIEND

HIST2H3PS2

histone cluster 2, H3, pseudogene 2

36 Gene Product Result for
Synonyms: p06
Species: Human HIST2H3PS2(440686)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_496408 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_496408 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_496408 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025303 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025303 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212291 predicted 66
2 SASI_Hs01_00212292 predicted 157
3 SASI_Hs01_00212293 predicted 159
4 SASI_Hs01_00212294 predicted 66
5 SASI_Hs01_00212295 predicted 153
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_496408
HIST2H3PS2 MISSION shRNA Bacterial Glycerol Stock
histone cluster 2, H3, pseudogene 2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000188828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_496408.1-437s1c1
Sequence:CCGGCTAAGCATGATAGCGGTGCAACTCGAGTTGCACCGCTATCATGCTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186625    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_496408.1-43s1c1
Sequence:CCGGGAAACTGACGATAATCCAGAACTCGAGTTCTGGATTATCGTCAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_496408.1-606s1c1
Sequence:CCGGCTTTGACTTCAGTAGGAAGATCTCGAGATCTTCCTACTGAAGTCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_496408.1-546s1c1
Sequence:CCGGCACAGATTTCTACTTTGTGTTCTCGAGAACACAAAGTAGAAATCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_496408
HIST2H3PS2 MISSION shRNA shRNA Plasmid DNA
histone cluster 2, H3, pseudogene 2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000188828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_496408.1-437s1c1
Sequence:CCGGCTAAGCATGATAGCGGTGCAACTCGAGTTGCACCGCTATCATGCTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186625    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_496408.1-43s1c1
Sequence:CCGGGAAACTGACGATAATCCAGAACTCGAGTTCTGGATTATCGTCAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_496408.1-606s1c1
Sequence:CCGGCTTTGACTTCAGTAGGAAGATCTCGAGATCTTCCTACTGAAGTCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_496408.1-546s1c1
Sequence:CCGGCACAGATTTCTACTTTGTGTTCTCGAGAACACAAAGTAGAAATCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_496408
HIST2H3PS2 MISSION shRNA Lentiviral Transduction Particles
histone cluster 2, H3, pseudogene 2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000188828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_496408.1-437s1c1
Sequence:CCGGCTAAGCATGATAGCGGTGCAACTCGAGTTGCACCGCTATCATGCTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186625    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_496408.1-43s1c1
Sequence:CCGGGAAACTGACGATAATCCAGAACTCGAGTTCTGGATTATCGTCAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_496408.1-606s1c1
Sequence:CCGGCTTTGACTTCAGTAGGAAGATCTCGAGATCTTCCTACTGAAGTCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_496408.1-546s1c1
Sequence:CCGGCACAGATTTCTACTTTGTGTTCTCGAGAACACAAAGTAGAAATCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)