EMAIL THIS PAGE TO A FRIEND

HIST2H4A

histone cluster 2, H4a

38 Gene Product Result for
Synonyms: FO108 H4 H4/n H4F2 H4FN HIST2H4
Gene ID:
Human(8370) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. This structure consists of approximately 146 bp of DNA wrapped around a nucleosome, an octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a member of the histone H4 family. Transcripts from this gene lack polyA tails; instead, they contain a palindromic termination element. This gene is found in a histone cluster on chromosome 1. This gene is one of four histone genes in the cluster that are duplicated; this record represents the centromeric copy. [provided by RefSeq, Jul 2008]
Rat(502913) histone cluster 2, H4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300871 Anti-Histone H4K20me1 antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry, western blot pricing
SAB4300872 Anti-Histone H4K20me2 antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunohistochemistry, western blot pricing
SAB4300873 Anti-Histone H4K20me3 antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunohistochemistry, western blot pricing
SAB4300868 Anti-Histone H4R3me2a antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunohistochemistry, western blot pricing
SAB4300870 Anti-Histone H4R3me2s antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003548 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003548 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003548 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003548 Rosetta Predictions human pricing
XM_001072499 Rosetta Predictions rat pricing
XM_578415 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003548 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047025 predicted 158
2 SASI_Hs01_00047026 predicted 146
3 SASI_Hs01_00047028 predicted 119
4 SASI_Hs01_00047029 predicted 88
5 SASI_Hs01_00047030 predicted 344
6 SASI_Hs01_00047031 predicted 233
7 SASI_Hs01_00047032 predicted 346
8 SASI_Hs01_00047033 predicted 138
9 SASI_Hs01_00047034 predicted 181
10 SASI_Hs01_00047027 predicted 155
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072499 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00339433 predicted 68
2 SASI_Rn02_00339434 predicted 130
3 SASI_Rn02_00339435 predicted 231
4 SASI_Rn02_00339436 predicted 311
5 SASI_Rn02_00339437 predicted 153
6 SASI_Rn02_00339438 predicted 227
7 SASI_Rn02_00339439 predicted 128
8 SASI_Rn02_00339440 predicted 246
9 SASI_Rn02_00339441 predicted 97
10 SASI_Rn02_00339442 predicted 78
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_578415 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00407845 predicted 61
2 SASI_Rn02_00407846 predicted 134
3 SASI_Rn02_00407847 predicted 230
4 SASI_Rn02_00407848 predicted 311
5 SASI_Rn02_00407849 predicted 158
6 SASI_Rn02_00407850 predicted 229
7 SASI_Rn02_00407851 predicted 131
8 SASI_Rn02_00407852 predicted 238
9 SASI_Rn02_00407853 predicted 90
10 SASI_Rn02_00407854 predicted 80
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003548
HIST2H4A MISSION shRNA Bacterial Glycerol Stock
histone cluster 2, H4a
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003548.2-88s1c1
Sequence:CCGGCAAGGTCTTGAGAGACAACATCTCGAGATGTTGTCTCTCAAGACCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003548.2-80s1c1
Sequence:CCGGCGCCACCGCAAGGTCTTGAGACTCGAGTCTCAAGACCTTGCGGTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003548.2-226s1c1
Sequence:CCGGGATTCGGGACGCAGTCACCTACTCGAGTAGGTGACTGCGTCCCGAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003548.2-235s1c1
Sequence:CCGGCGCAGTCACCTACACCGAGCACTCGAGTGCTCGGTGTAGGTGACTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003548.2-162s21c1
Sequence:CCCGAGCGGATCTCTGGCCTCATTTCTCGAGAAATGAGGCCAGAGATCCGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003548.2-268s21c1
Sequence:CCGGGACCGTCACAGCCATGGATGTCTCGAGACATCCATGGCTGTGACGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003548.2-285s21c1
Sequence:CCGGATGTGGTGTACGCGCTCAAGCCTCGAGGCTTGAGCGCGTACACCACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003548.2-102s21c1
Sequence:CCGGACAACATTCAGGGCATCACCACTCGAGTGGTGATGCCCTGAATGTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003548
HIST2H4A MISSION shRNA shRNA Plasmid DNA
histone cluster 2, H4a
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003548.2-88s1c1
Sequence:CCGGCAAGGTCTTGAGAGACAACATCTCGAGATGTTGTCTCTCAAGACCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003548.2-80s1c1
Sequence:CCGGCGCCACCGCAAGGTCTTGAGACTCGAGTCTCAAGACCTTGCGGTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003548.2-226s1c1
Sequence:CCGGGATTCGGGACGCAGTCACCTACTCGAGTAGGTGACTGCGTCCCGAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003548.2-235s1c1
Sequence:CCGGCGCAGTCACCTACACCGAGCACTCGAGTGCTCGGTGTAGGTGACTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003548.2-162s21c1
Sequence:CCCGAGCGGATCTCTGGCCTCATTTCTCGAGAAATGAGGCCAGAGATCCGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003548.2-268s21c1
Sequence:CCGGGACCGTCACAGCCATGGATGTCTCGAGACATCCATGGCTGTGACGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003548.2-285s21c1
Sequence:CCGGATGTGGTGTACGCGCTCAAGCCTCGAGGCTTGAGCGCGTACACCACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003548.2-102s21c1
Sequence:CCGGACAACATTCAGGGCATCACCACTCGAGTGGTGATGCCCTGAATGTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003548
HIST2H4A MISSION shRNA Lentiviral Transduction Particles
histone cluster 2, H4a
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003548.2-88s1c1
Sequence:CCGGCAAGGTCTTGAGAGACAACATCTCGAGATGTTGTCTCTCAAGACCTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003548.2-80s1c1
Sequence:CCGGCGCCACCGCAAGGTCTTGAGACTCGAGTCTCAAGACCTTGCGGTGGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003548.2-226s1c1
Sequence:CCGGGATTCGGGACGCAGTCACCTACTCGAGTAGGTGACTGCGTCCCGAATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003548.2-235s1c1
Sequence:CCGGCGCAGTCACCTACACCGAGCACTCGAGTGCTCGGTGTAGGTGACTGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003548.2-162s21c1
Sequence:CCCGAGCGGATCTCTGGCCTCATTTCTCGAGAAATGAGGCCAGAGATCCGCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003548.2-268s21c1
Sequence:CCGGGACCGTCACAGCCATGGATGTCTCGAGACATCCATGGCTGTGACGGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003548.2-285s21c1
Sequence:CCGGATGTGGTGTACGCGCTCAAGCCTCGAGGCTTGAGCGCGTACACCACATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003548.2-102s21c1
Sequence:CCGGACAACATTCAGGGCATCACCACTCGAGTGGTGATGCCCTGAATGTTGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)