EMAIL THIS PAGE TO A FRIEND

HIST2H4B

histone cluster 2, H4b

65 Gene Product Result for
Synonyms: H4/o
Species: Human HIST2H4B(554313)
Gene ID:
Human(554313) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. This structure consists of approximately 146 bp of DNA wrapped around a nucleosome, an octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a member of the histone H4 family. Transcripts from this gene lack polyA tails; instead, they contain a palindromic termination element. This gene is found in a histone cluster on chromosome 1. This gene is one of four histone genes in the cluster that are duplicated; this record represents the telomeric copy. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001034077 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001034077 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001034077 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU107741 MISSION® esiRNA esiRNA human HIST2H4B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001034077 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034077 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189388 predicted 155
2 SASI_Hs01_00189389 predicted 145
3 SASI_Hs01_00189391 predicted 120
4 SASI_Hs01_00189392 predicted 81
5 SASI_Hs01_00189393 predicted 339
6 SASI_Hs01_00189394 predicted 234
7 SASI_Hs01_00189395 predicted 341
8 SASI_Hs01_00189396 predicted 139
9 SASI_Hs01_00189397 predicted 187
10 SASI_Hs01_00189390 predicted 154
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001034077
HIST2H4B MISSION shRNA Bacterial Glycerol Stock
histone cluster 2, H4b
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034077.4-222s21c1
Sequence:CCGGATGTGATTCGGGACGCAGTCACTCGAGTGACTGCGTCCCGAATCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034077.2-198s1c1
Sequence:CCGGGTGTTCCTGGAGAATGTGATTCTCGAGAATCACATTCTCCAGGAACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034077.4-90s21c1
Sequence:CCGGAGGTCTTGAGAGACAACATTCCTCGAGGAATGTTGTCTCTCAAGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034077.4-101s21c1
Sequence:CCGGGACAACATTCAGGGCATCACCCTCGAGGGTGATGCCCTGAATGTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034077.4-163s21c1
Sequence:CCGGGCGGATCTCTGGCCTCATTTACTCGAGTAAATGAGGCCAGAGATCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034077.2-77s1c1
Sequence:CCGGCAAGGTCTTGAGAGACAACATCTCGAGATGTTGTCTCTCAAGACCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034077.2-192s1c1
Sequence:CCGGCTGAAGGTGTTCCTGGAGAATCTCGAGATTCTCCAGGAACACCTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034077.4-204s21c1
Sequence:CCGGTGAAGGTGTTCCTGGAGAATGCTCGAGCATTCTCCAGGAACACCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001034077
HIST2H4B MISSION shRNA shRNA Plasmid DNA
histone cluster 2, H4b
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034077.4-222s21c1
Sequence:CCGGATGTGATTCGGGACGCAGTCACTCGAGTGACTGCGTCCCGAATCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034077.2-198s1c1
Sequence:CCGGGTGTTCCTGGAGAATGTGATTCTCGAGAATCACATTCTCCAGGAACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034077.4-90s21c1
Sequence:CCGGAGGTCTTGAGAGACAACATTCCTCGAGGAATGTTGTCTCTCAAGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034077.4-101s21c1
Sequence:CCGGGACAACATTCAGGGCATCACCCTCGAGGGTGATGCCCTGAATGTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034077.4-163s21c1
Sequence:CCGGGCGGATCTCTGGCCTCATTTACTCGAGTAAATGAGGCCAGAGATCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034077.2-77s1c1
Sequence:CCGGCAAGGTCTTGAGAGACAACATCTCGAGATGTTGTCTCTCAAGACCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034077.2-192s1c1
Sequence:CCGGCTGAAGGTGTTCCTGGAGAATCTCGAGATTCTCCAGGAACACCTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034077.4-204s21c1
Sequence:CCGGTGAAGGTGTTCCTGGAGAATGCTCGAGCATTCTCCAGGAACACCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001034077
HIST2H4B MISSION shRNA Lentiviral Transduction Particles
histone cluster 2, H4b
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034077.4-222s21c1
Sequence:CCGGATGTGATTCGGGACGCAGTCACTCGAGTGACTGCGTCCCGAATCACATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034077.2-198s1c1
Sequence:CCGGGTGTTCCTGGAGAATGTGATTCTCGAGAATCACATTCTCCAGGAACACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034077.4-90s21c1
Sequence:CCGGAGGTCTTGAGAGACAACATTCCTCGAGGAATGTTGTCTCTCAAGACCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034077.4-101s21c1
Sequence:CCGGGACAACATTCAGGGCATCACCCTCGAGGGTGATGCCCTGAATGTTGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034077.4-163s21c1
Sequence:CCGGGCGGATCTCTGGCCTCATTTACTCGAGTAAATGAGGCCAGAGATCCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034077.2-77s1c1
Sequence:CCGGCAAGGTCTTGAGAGACAACATCTCGAGATGTTGTCTCTCAAGACCTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034077.2-192s1c1
Sequence:CCGGCTGAAGGTGTTCCTGGAGAATCTCGAGATTCTCCAGGAACACCTTCAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034077.4-204s21c1
Sequence:CCGGTGAAGGTGTTCCTGGAGAATGCTCGAGCATTCTCCAGGAACACCTTCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)