EMAIL THIS PAGE TO A FRIEND

HIST3H2A

histone cluster 3, H2a

53 Gene Product Result for
UniProtKB ID: Q7L7L0, B2R4S4
Gene ID:
Human(92815) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a member of the histone H2A family. Transcripts from this gene contain a palindromic termination element. [provided by RefSeq, Jul 2008]
Mouse(319162) histone cluster 3, H2a
Rat(64646) histone cluster 3, H2a
cow(538911) histone cluster 3, H2a
dog(482203) histone cluster 3, H2a
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4504674 Anti-phospho-Histone H2A (pThr121) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178218 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178218 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178218 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033445 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033445 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033445 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU203711 MISSION® esiRNA esiRNA targeting mouse Hist3h2a mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033445 Rosetta Predictions human pricing
NM_021840 Rosetta Predictions rat pricing
XM_001053023 Rosetta Predictions rat pricing
NM_178218 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033445 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226323 predicted 200
2 SASI_Hs01_00226324 predicted 203
3 SASI_Hs01_00226325 predicted 197
4 SASI_Hs01_00226326 predicted 191
5 SASI_Hs01_00226327 predicted 179
6 SASI_Hs01_00226328 predicted 323
7 SASI_Hs01_00226329 predicted 58
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021840 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083165 predicted 774
2 SASI_Rn01_00083166 predicted 887
3 SASI_Rn02_00262850 predicted 728
4 SASI_Rn01_00083169 predicted 641
5 SASI_Rn01_00083170 predicted 597
6 SASI_Rn02_00262851 predicted 764
7 SASI_Rn01_00083171 predicted 670
8 SASI_Rn02_00262852 predicted 839
9 SASI_Rn01_00083172 predicted 852
10 SASI_Rn02_00262853 predicted 714
11 SASI_Rn01_00083167 predicted 460
12 SASI_Rn01_00083168 predicted 717
13 SASI_Rn01_00083173 predicted 848
14 SASI_Rn01_00083174 predicted 662
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053023 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00271066 predicted 774
2 SASI_Rn02_00271067 predicted 884
3 SASI_Rn02_00271068 predicted 721
4 SASI_Rn02_00271069 predicted 640
5 SASI_Rn02_00271070 predicted 593
6 SASI_Rn02_00271071 predicted 765
7 SASI_Rn02_00271072 predicted 664
8 SASI_Rn02_00271073 predicted 834
9 SASI_Rn02_00271074 predicted 849
10 SASI_Rn02_00271075 predicted 715
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178218 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056455 predicted 248
2 SASI_Mm01_00056456 predicted 775
3 SASI_Mm01_00056457 predicted 740
4 SASI_Mm01_00056458 predicted 917
5 SASI_Mm01_00056459 predicted 255
6 SASI_Mm01_00056461 predicted 563
7 SASI_Mm01_00056462 predicted 660
8 SASI_Mm01_00056463 predicted 503
9 SASI_Mm01_00056464 predicted 245
10 SASI_Mm02_00348625 predicted 691
11 SASI_Mm01_00056460 predicted 877
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178218
VALIDATED
HIST3H2A MISSION shRNA Bacterial Glycerol Stock
histone cluster 3, H2a
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000340607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178218.3-268s21c1
Sequence:CCGGGCGACAATAAGAAGACGCGAACTCGAGTTCGCGTCTTCTTATTGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178218.2-219s1c1
Sequence:CCGGGCTAGAATATCTGACTGCTGACTCGAGTCAGCAGTCAGATATTCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178218.2-270s1c1
Sequence:CCGGCGACAATAAGAAGACGCGAATCTCGAGATTCGCGTCTTCTTATTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178218.2-153s1c1
Sequence:CCGGCCTTCTCCGTAAGGGTAATTACTCGAGTAATTACCCTTACGGAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097009    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178218.2-988s1c1
Sequence:CCGGGCCTGCTTAGTGGTAGGATTACTCGAGTAATCCTACCACTAAGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178218.2-212s1c1
Sequence:CCGGCGGCTGTGCTAGAATATCTGACTCGAGTCAGATATTCTAGCACAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178218.3-241s21c1
Sequence:CCGGTCCTGGAATTGGCTGGTAATGCTCGAGCATTACCAGCCAATTCCAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340608    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178218.3-794s21c1
Sequence:CCGGTCTATTGAAACTGGGTTAAATCTCGAGATTTAACCCAGTTTCAATAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178218.3-151s21c1
Sequence:CCGGGCCTTCTCCGTAAGGGTAATTCTCGAGAATTACCCTTACGGAGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178218.3-208s21c1
Sequence:CCGGTGGCGGCTGTGCTAGAATATCCTCGAGGATATTCTAGCACAGCCGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178218
VALIDATED
HIST3H2A MISSION shRNA shRNA Plasmid DNA
histone cluster 3, H2a
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000340607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178218.3-268s21c1
Sequence:CCGGGCGACAATAAGAAGACGCGAACTCGAGTTCGCGTCTTCTTATTGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178218.2-219s1c1
Sequence:CCGGGCTAGAATATCTGACTGCTGACTCGAGTCAGCAGTCAGATATTCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178218.2-270s1c1
Sequence:CCGGCGACAATAAGAAGACGCGAATCTCGAGATTCGCGTCTTCTTATTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178218.2-153s1c1
Sequence:CCGGCCTTCTCCGTAAGGGTAATTACTCGAGTAATTACCCTTACGGAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097009    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178218.2-988s1c1
Sequence:CCGGGCCTGCTTAGTGGTAGGATTACTCGAGTAATCCTACCACTAAGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178218.2-212s1c1
Sequence:CCGGCGGCTGTGCTAGAATATCTGACTCGAGTCAGATATTCTAGCACAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178218.3-241s21c1
Sequence:CCGGTCCTGGAATTGGCTGGTAATGCTCGAGCATTACCAGCCAATTCCAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340608    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178218.3-794s21c1
Sequence:CCGGTCTATTGAAACTGGGTTAAATCTCGAGATTTAACCCAGTTTCAATAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178218.3-151s21c1
Sequence:CCGGGCCTTCTCCGTAAGGGTAATTCTCGAGAATTACCCTTACGGAGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178218.3-208s21c1
Sequence:CCGGTGGCGGCTGTGCTAGAATATCCTCGAGGATATTCTAGCACAGCCGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178218
VALIDATED
HIST3H2A MISSION shRNA Lentiviral Transduction Particles
histone cluster 3, H2a
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000340607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178218.3-268s21c1
Sequence:CCGGGCGACAATAAGAAGACGCGAACTCGAGTTCGCGTCTTCTTATTGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178218.2-219s1c1
Sequence:CCGGGCTAGAATATCTGACTGCTGACTCGAGTCAGCAGTCAGATATTCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178218.2-270s1c1
Sequence:CCGGCGACAATAAGAAGACGCGAATCTCGAGATTCGCGTCTTCTTATTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178218.2-153s1c1
Sequence:CCGGCCTTCTCCGTAAGGGTAATTACTCGAGTAATTACCCTTACGGAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097009    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178218.2-988s1c1
Sequence:CCGGGCCTGCTTAGTGGTAGGATTACTCGAGTAATCCTACCACTAAGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_178218.2-212s1c1
Sequence:CCGGCGGCTGTGCTAGAATATCTGACTCGAGTCAGATATTCTAGCACAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178218.3-241s21c1
Sequence:CCGGTCCTGGAATTGGCTGGTAATGCTCGAGCATTACCAGCCAATTCCAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340608    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178218.3-794s21c1
Sequence:CCGGTCTATTGAAACTGGGTTAAATCTCGAGATTTAACCCAGTTTCAATAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178218.3-151s21c1
Sequence:CCGGGCCTTCTCCGTAAGGGTAATTCTCGAGAATTACCCTTACGGAGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_178218.3-208s21c1
Sequence:CCGGTGGCGGCTGTGCTAGAATATCCTCGAGGATATTCTAGCACAGCCGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033445
HIST3H2A MISSION shRNA Bacterial Glycerol Stock
histone cluster 3, H2a
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033445.2-200s1c1
Sequence:CCGGCCGCGGTGCTCGAGTACTTGACTCGAGTCAAGTACTCGAGCACCGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033445.2-143s1c1
Sequence:CCGGTGCTCCGCAAGGGCAACTATTCTCGAGAATAGTTGCCCTTGCGGAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033445.2-220s1c1
Sequence:CCGGACTGCCGAGATCCTGGAGCTTCTCGAGAAGCTCCAGGATCTCGGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033445.2-210s1c1
Sequence:CCGGCGAGTACTTGACTGCCGAGATCTCGAGATCTCGGCAGTCAAGTACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033445.2-80s1c1
Sequence:CCGGCCAAGGCTAAGTCGCGCTCGTCTCGAGACGAGCGCGACTTAGCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033445.2-312s21c1
Sequence:CCGGCGACGAGGAGCTCAACAAGCTCTCGAGAGCTTGTTGAGCTCCTCGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033445.2-258s21c1
Sequence:CCGGCGACAACAAGAAGACGCGCATCTCGAGATGCGCGTCTTCTTGTTGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033445
HIST3H2A MISSION shRNA shRNA Plasmid DNA
histone cluster 3, H2a
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033445.2-200s1c1
Sequence:CCGGCCGCGGTGCTCGAGTACTTGACTCGAGTCAAGTACTCGAGCACCGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033445.2-143s1c1
Sequence:CCGGTGCTCCGCAAGGGCAACTATTCTCGAGAATAGTTGCCCTTGCGGAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033445.2-220s1c1
Sequence:CCGGACTGCCGAGATCCTGGAGCTTCTCGAGAAGCTCCAGGATCTCGGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033445.2-210s1c1
Sequence:CCGGCGAGTACTTGACTGCCGAGATCTCGAGATCTCGGCAGTCAAGTACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033445.2-80s1c1
Sequence:CCGGCCAAGGCTAAGTCGCGCTCGTCTCGAGACGAGCGCGACTTAGCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033445.2-312s21c1
Sequence:CCGGCGACGAGGAGCTCAACAAGCTCTCGAGAGCTTGTTGAGCTCCTCGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033445.2-258s21c1
Sequence:CCGGCGACAACAAGAAGACGCGCATCTCGAGATGCGCGTCTTCTTGTTGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033445
HIST3H2A MISSION shRNA Lentiviral Transduction Particles
histone cluster 3, H2a
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033445.2-200s1c1
Sequence:CCGGCCGCGGTGCTCGAGTACTTGACTCGAGTCAAGTACTCGAGCACCGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033445.2-143s1c1
Sequence:CCGGTGCTCCGCAAGGGCAACTATTCTCGAGAATAGTTGCCCTTGCGGAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033445.2-220s1c1
Sequence:CCGGACTGCCGAGATCCTGGAGCTTCTCGAGAAGCTCCAGGATCTCGGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033445.2-210s1c1
Sequence:CCGGCGAGTACTTGACTGCCGAGATCTCGAGATCTCGGCAGTCAAGTACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033445.2-80s1c1
Sequence:CCGGCCAAGGCTAAGTCGCGCTCGTCTCGAGACGAGCGCGACTTAGCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033445.2-312s21c1
Sequence:CCGGCGACGAGGAGCTCAACAAGCTCTCGAGAGCTTGTTGAGCTCCTCGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033445.2-258s21c1
Sequence:CCGGCGACAACAAGAAGACGCGCATCTCGAGATGCGCGTCTTCTTGTTGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)