EMAIL THIS PAGE TO A FRIEND

HIST3H2BA

histone cluster 3, H2ba, pseudogene

26 Gene Product Result for
Gene ID:
Mouse(78303) histone cluster 3, H2ba
Rat(303175) histone cluster 3, H2ba
Goat(100861325) histone H2B type 3-A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030082 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030082 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030082 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU095181 MISSION® esiRNA esiRNA targeting mouse Hist3h2ba (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001111127 Rosetta Predictions rat pricing
NM_030082 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111127 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251522 predicted 263
2 SASI_Rn02_00251523 predicted 256
3 SASI_Rn02_00251524 predicted 257
4 SASI_Rn02_00251525 predicted 255
5 SASI_Rn02_00251526 predicted 347
6 SASI_Rn02_00251527 predicted 355
7 SASI_Rn02_00251528 predicted 353
8 SASI_Rn02_00251529 predicted 257
9 SASI_Rn02_00251530 predicted 357
10 SASI_Rn02_00251531 predicted 82
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030082 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083636 predicted 571
2 SASI_Mm01_00083637 predicted 563
3 SASI_Mm01_00083638 predicted 567
4 SASI_Mm01_00083639 predicted 569
5 SASI_Mm01_00083640 predicted 495
6 SASI_Mm01_00083641 predicted 550
7 SASI_Mm01_00083643 predicted 498
8 SASI_Mm01_00083644 predicted 492
9 SASI_Mm01_00083645 predicted 572
10 SASI_Mm02_00336481 predicted 585
11 SASI_Mm01_00083642 predicted 483
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030082
HIST3H2BA MISSION shRNA Bacterial Glycerol Stock
histone cluster 3, H2ba, pseudogene
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030082.1-450s1c1
Sequence:CCGGAGAGCCACCTTCCAAGCTCAACTCGAGTTGAGCTTGGAAGGTGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030082.1-387s1c1
Sequence:CCGGCACCAAATACACCAGCTCCAACTCGAGTTGGAGCTGGTGTATTTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030082.1-138s1c1
Sequence:CCGGGAGCTACTCCATCTACGTGTACTCGAGTACACGTAGATGGAGTAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030082.1-82s1c1
Sequence:CCGGGCCATCACCAAGGCTCAGAAACTCGAGTTTCTGAGCCTTGGTGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030082.1-61s1c1
Sequence:CCGGCCGAAGAAAGGCTCCAAGAAACTCGAGTTTCTTGGAGCCTTTCTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030082
HIST3H2BA MISSION shRNA shRNA Plasmid DNA
histone cluster 3, H2ba, pseudogene
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030082.1-450s1c1
Sequence:CCGGAGAGCCACCTTCCAAGCTCAACTCGAGTTGAGCTTGGAAGGTGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030082.1-387s1c1
Sequence:CCGGCACCAAATACACCAGCTCCAACTCGAGTTGGAGCTGGTGTATTTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030082.1-138s1c1
Sequence:CCGGGAGCTACTCCATCTACGTGTACTCGAGTACACGTAGATGGAGTAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030082.1-82s1c1
Sequence:CCGGGCCATCACCAAGGCTCAGAAACTCGAGTTTCTGAGCCTTGGTGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030082.1-61s1c1
Sequence:CCGGCCGAAGAAAGGCTCCAAGAAACTCGAGTTTCTTGGAGCCTTTCTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030082
HIST3H2BA MISSION shRNA Lentiviral Transduction Particles
histone cluster 3, H2ba, pseudogene
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030082.1-450s1c1
Sequence:CCGGAGAGCCACCTTCCAAGCTCAACTCGAGTTGAGCTTGGAAGGTGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030082.1-387s1c1
Sequence:CCGGCACCAAATACACCAGCTCCAACTCGAGTTGGAGCTGGTGTATTTGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030082.1-138s1c1
Sequence:CCGGGAGCTACTCCATCTACGTGTACTCGAGTACACGTAGATGGAGTAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030082.1-82s1c1
Sequence:CCGGGCCATCACCAAGGCTCAGAAACTCGAGTTTCTGAGCCTTGGTGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030082.1-61s1c1
Sequence:CCGGCCGAAGAAAGGCTCCAAGAAACTCGAGTTTCTTGGAGCCTTTCTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)