EMAIL THIS PAGE TO A FRIEND

HIST3H2BB

histone cluster 3, H2bb

30 Gene Product Result for
Synonyms: H2Bb
UniProtKB ID: Q8N257, A4FU05, Q3ZCP6, Q5TA30
Gene ID:
Human(128312) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a member of the histone H2B family. Transcripts from this gene contain a palindromic termination element. [provided by RefSeq, Jul 2008]
Rat(691488) histone cluster 3, H2bb
cow(520120) histone cluster 3, H2bb
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175055 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175055 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175055 MISSION® shRNA Lentiviral Transduction Particles human pricing

Related Products

Product # Description Species Add to Cart
 
07-373 Anti-acetyl-Histone H2B Antibody Detect acetyl-Histone H2B also known as Histone H2B with Anti-acetyl-Histone H2B Antibody (Rabbit Polyclonal Antibody), that has been demonstrated to work in WB. pricing
ABE1065 Anti-acetyl Histone H2B Antibody (Lys5) Detect Histone H2B using this rabbit polyclonal antibody, Anti-acetyl Histone H2B Antibody (Lys5) validated for use in western blotting, Dot Blot, IHC & IP. pricing
07-564 Anti-acetyl-Histone H2B (Lys120) Antibody Use Anti-acetyl-Histone H2B (Lys120) Antibody (Rabbit Polyclonal Antibody) validated in DB, WB, PIA to detect acetyl-Histone H2B (Lys120) also known as H2BK120Ac, Histone H2B (acetyl K120). pricing
ABE269 Anti-acetyl-Histone H2B (Lys24) Antibody Use Anti-acetyl-Histone H2B (Lys24) Antibody (Rabbit Polyclonal Antibody) validated in WB, IP, DB to detect acetyl-Histone H2B (Lys24) also known as H2BK24Ac, Histone H2B (acetyl K24). pricing
07-382 Anti-acetyl-Histone H2B (Lys5) Antibody Anti-acetyl-Histone H2B (Lys5) Antibody is a Rabbit Polyclonal Antibody for detection of acetyl-Histone H2B (Lys5) also known as H2BK5Ac, Histone H2B (acetyl K5) & has been validated in WB. pricing
AB1623 Anti-Histone H2B Antibody Detect Histone H2B also known as Histone H2B with Anti-Histone H2B Antibody (Rabbit Polyclonal Antibody), that has been demonstrated to work in WB & IHC. pricing
07-191 Anti-phospho-Histone H2B (Ser14) Antibody Use Anti-phospho-Histone H2B (Ser14) Antibody (Rabbit Polyclonal Antibody) validated in ELISA, ICC, IHC, WB to detect phospho-Histone H2B (Ser14) also known as H2BS14P, Histone H2B (phospho S14). pricing
MABE433 Anti-phospho Histone H2B (Tyr37), clone 15 Antibody This Anti-phospho Histone H2B (Tyr37) antibody, clone 15 is validated for use in western blotting & ChIP for the detection of phospho Histone H2B (Tyr37). pricing
12-407 Histone H2B Peptide, biotin conjugate, residues 1-21 Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, & H4). This gene is intronless & encodes a member of the histone H2B family. pricing
12-408 Histone H2B Peptide, biotin conjugate, residues 21-41 Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. pricing
14-491 Histone H2B Protein, human recombinant, 100 µg Recombinant human Histone H2B produced in E. coli, purified using FPLC. For use in Enzyme Assays. pricing
14-410 Histone H2B, Recombinant Xenopus laevis Recombinant Xenopus laevis Histone H2B. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175055 Rosetta Predictions human pricing
NM_001109641 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175055 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207311 predicted 398
2 SASI_Hs01_00207312 predicted 415
3 SASI_Hs01_00207313 predicted 70
4 SASI_Hs02_00368952 predicted 66
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109641 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250342 predicted 469
2 SASI_Rn02_00250343 predicted 314
3 SASI_Rn02_00250344 predicted 306
4 SASI_Rn02_00250345 predicted 466
5 SASI_Rn02_00250346 predicted 306
6 SASI_Rn02_00250347 predicted 464
7 SASI_Rn02_00250348 predicted 466
8 SASI_Rn02_00250349 predicted 404
9 SASI_Rn02_00250350 predicted 402
10 SASI_Rn02_00250351 predicted 505
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175055
HIST3H2BB MISSION shRNA Bacterial Glycerol Stock
histone cluster 3, H2bb
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175055.2-51s1c1
Sequence:CCGGGCGCCCAAGAAGGGTTCTAAACTCGAGTTTAGAACCCTTCTTGGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175055.2-300s1c1
Sequence:CCGGCGCGAAGTGCAGACGGCCGTTCTCGAGAACGGCCGTCTGCACTTCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175055.2-131s1c1
Sequence:CCGGGAGCTATTCTATCTACGTGTACTCGAGTACACGTAGATAGAATAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175055.2-50s1c1
Sequence:CCGGTGCGCCCAAGAAGGGTTCTAACTCGAGTTAGAACCCTTCTTGGGCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175055.2-122s1c1
Sequence:CCGGCCGCAAGGAGAGCTATTCTATCTCGAGATAGAATAGCTCTCCTTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175055.2-371s21c1
Sequence:CCGGCAAGGCTGTCACCAAGTACACCTCGAGGTGTACTTGGTGACAGCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175055.2-89s21c1
Sequence:CCGGACAGAAGAAGGACGGCAAGAACTCGAGTTCTTGCCGTCCTTCTTCTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175055.2-268s21c1
Sequence:CCGGCACACTACAACAAGCGCTCCACTCGAGTGGAGCGCTTGTTGTAGTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175055
HIST3H2BB MISSION shRNA shRNA Plasmid DNA
histone cluster 3, H2bb
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175055.2-51s1c1
Sequence:CCGGGCGCCCAAGAAGGGTTCTAAACTCGAGTTTAGAACCCTTCTTGGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175055.2-300s1c1
Sequence:CCGGCGCGAAGTGCAGACGGCCGTTCTCGAGAACGGCCGTCTGCACTTCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175055.2-131s1c1
Sequence:CCGGGAGCTATTCTATCTACGTGTACTCGAGTACACGTAGATAGAATAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175055.2-50s1c1
Sequence:CCGGTGCGCCCAAGAAGGGTTCTAACTCGAGTTAGAACCCTTCTTGGGCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175055.2-122s1c1
Sequence:CCGGCCGCAAGGAGAGCTATTCTATCTCGAGATAGAATAGCTCTCCTTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175055.2-371s21c1
Sequence:CCGGCAAGGCTGTCACCAAGTACACCTCGAGGTGTACTTGGTGACAGCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175055.2-89s21c1
Sequence:CCGGACAGAAGAAGGACGGCAAGAACTCGAGTTCTTGCCGTCCTTCTTCTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175055.2-268s21c1
Sequence:CCGGCACACTACAACAAGCGCTCCACTCGAGTGGAGCGCTTGTTGTAGTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175055
HIST3H2BB MISSION shRNA Lentiviral Transduction Particles
histone cluster 3, H2bb
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175055.2-51s1c1
Sequence:CCGGGCGCCCAAGAAGGGTTCTAAACTCGAGTTTAGAACCCTTCTTGGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175055.2-300s1c1
Sequence:CCGGCGCGAAGTGCAGACGGCCGTTCTCGAGAACGGCCGTCTGCACTTCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175055.2-131s1c1
Sequence:CCGGGAGCTATTCTATCTACGTGTACTCGAGTACACGTAGATAGAATAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175055.2-50s1c1
Sequence:CCGGTGCGCCCAAGAAGGGTTCTAACTCGAGTTAGAACCCTTCTTGGGCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175055.2-122s1c1
Sequence:CCGGCCGCAAGGAGAGCTATTCTATCTCGAGATAGAATAGCTCTCCTTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175055.2-371s21c1
Sequence:CCGGCAAGGCTGTCACCAAGTACACCTCGAGGTGTACTTGGTGACAGCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175055.2-89s21c1
Sequence:CCGGACAGAAGAAGGACGGCAAGAACTCGAGTTCTTGCCGTCCTTCTTCTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175055.2-268s21c1
Sequence:CCGGCACACTACAACAAGCGCTCCACTCGAGTGGAGCGCTTGTTGTAGTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)