EMAIL THIS PAGE TO A FRIEND

HIST3H3

histone cluster 3, H3

147 Gene Product Result for
Synonyms: H3.4 H3/g H3FT H3t
UniProtKB ID: Q16695, B2R5K3, Q6FGU4
Gene ID:
Human(8290) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a member of the histone H3 family. Transcripts from this gene lack polyA tails; instead, they contain a palindromic termination element. This gene is located separately from the other H3 genes that are in the histone gene cluster on chromosome 6p22-p21.3. [provided by RefSeq, Jul 2008]
Rat(287352) histone cluster 3, H3
dog(480760) histone cluster 3, H3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
H9161 Anti-acetyl- & phospho-Histone H3 (Ac-Lys9, pSer10) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution frog, bovine, human, mouse, Caenorhabditis elegans, Drosophila, rat, chicken
immunofluorescence, microarray, western blot pricing
SAB4200485 Anti-acetyl-Histone H3 (Ac-Lys27) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody mouse, human, rat
immunofluorescence, immunohistochemistry, western blot pricing
H9286 Anti-acetyl-Histone H3 (Ac-Lys9) antibody produced in rabbit 2-2.5 mg/mL, affinity isolated antibody, buffered aqueous solution Drosophila, human, bovine, frog, chicken, Caenorhabditis elegans, rat, mouse
immunofluorescence, microarray, western blot pricing
H0913 Anti-acetyl-Histone H3 (Ac-Lys9) antibody, Mouse monoclonal clone AH3-120, purified from hybridoma cell culture human, mouse, bovine, frog, chicken, rat, Caenorhabditis elegans, Drosophila
ELISA, immunocytochemistry, microarray, western blot pricing
SAB4200389 Anti-acetyl-Histone H3 [Ac-Lys23] antibody produced in rabbit IgG fraction of antiserum, antigen mol wt ~15 kDa human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB4200328 Anti-acetyl-Histone H3 [Ac-Lys56] IgG fraction of antiserum human, mouse, rat
western blot pricing
SAB4200353 Anti-acetyl-Histone H4 [Ac-Lys12] antibody produced in rabbit IgG fraction of antiserum mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
D5692 Anti-dimethyl-Histone H3 (diMe-Lys4) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution Caenorhabditis elegans, Arabidopsis thaliana, Drosophila, human, bovine, frog, rat, chicken, mouse
ChIP, microarray, western blot pricing
D5567 Anti-dimethyl-Histone H3 (diMe-Lys9) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution Arabidopsis thaliana, Drosophila, Caenorhabditis elegans, bovine, human, chicken, frog, rat, mouse
ChIP, microarray, western blot pricing
AV01011 Anti-H3F3A antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB2107839 Anti-HIST3H3 antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
H0164 Anti-Histone H3 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, plant, human, Drosophila, rat, chicken, Xenopus
immunofluorescence, western blot pricing
SAB4300869 Anti-Histone H4R3me1 antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunofluorescence, immunoprecipitation (IP), western blot pricing
M4819 Anti-methyl-Histone H3 (Me-Lys4) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution chicken, Caenorhabditis elegans, Drosophila, bovine, mouse, human, frog, Arabidopsis thaliana, rat
western blot pricing
H7162 Anti-methyl-Histone H3 (Me-Lys9) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution Caenorhabditis elegans, mouse, rat, bovine, chicken, frog, Drosophila, human
microarray, western blot pricing
H0412 Anti-phospho-Histone H3 (pSer10) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution frog, human, mouse, Drosophila, rat, Caenorhabditis elegans, bovine, chicken
immunofluorescence, microarray, western blot pricing
SAB5100007 Imprint®ChIP-Validated Anti-Acetyl-Histone H3 (Ac-Lys9) (H3K9ac) antibody produced in rabbit affinity isolated antibody human
ChIP, western blot pricing
SAB5100009 Imprint ® ChiP-Validated Anti-methyl-Histone H3 (Me-Lys4) (H3K4me1) antibody produced in rabbit affinity isolated antibody chicken, frog, mouse, bovine, human
ChIP, western blot pricing
SAB5100008 Imprint® ChIP-Validated Anti-methyl-Histone H3 (Me-Lys9) (H3K9me1) affinity isolated antibody human
ChIP, western blot pricing
H0788 Monoclonal Anti-acetyl- & phospho-Histone H3 (Ac-Lys9, pSer10) antibody produced in mouse ~2 mg/mL, clone APH3-64, purified immunoglobulin, buffered aqueous solution frog, rat, Drosophila, Caenorhabditis elegans, human, mouse, bovine, chicken
ELISA, immunoprecipitation (IP), microarray, western blot pricing
H9908 Monoclonal Anti-phospho-Histone H3 (pSer28) antibody produced in rat ~0.5 mg/mL, clone HTA28, purified immunoglobulin, buffered aqueous solution human, bovine, hamster, mouse
flow cytometry, immunocytochemistry, microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003493 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003493 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003493 MISSION® shRNA Lentiviral Transduction Particles human pricing

Related Products

Product # Description Species Add to Cart
 
17-245 Acetyl-Histone H3 Immunoprecipitation (ChIP) Assay Kit For use to immunoprecipitate transcriptionally active chromatin from mammalian cells using anti-acetyl-Histone H3. pricing
06-599 Anti-acetyl-Histone H3 Antibody Detect acetyl-Histone H3 with Anti-acetyl-Histone H3 Antibody (Rabbit Polyclonal Antibody), that has been shown to work in WB, ICC, ChIP, ChIP-seq. pricing
06-599-AF488 Anti-acetyl-Histone H3 Antibody, Alexa Fluor® 488 Conjugate This Anti-acetyl-Histone H3 Antibody, Alexa Fluor® 488 Conjugate is validated for use in Immunocytochemistry for the detection of acetyl-Histone H3. pricing
06-599-AF647 Anti-acetyl-Histone H3 Antibody, Alexa Fluor® 647 Conjugate This Anti-acetyl-Histone H3 Antibody, Alexa Fluor® 647 Conjugate is validated for use in Immunocytochemistry for the detection of acetyl-Histone H3. pricing
06-911 Anti-acetyl-Histone H3 (Lys14) Antibody Use Anti-acetyl-Histone H3 (Lys14) Antibody (Rabbit Polyclonal Antibody) validated in ICC, IP, WB to detect acetyl-Histone H3 (Lys14) also known as H3K14Ac, Histone H3 (acetyl K14). pricing
07-353 Anti-acetyl-Histone H3 (Lys14) Antibody Anti-acetyl-Histone H3 (Lys14) Antibody is a rabbit polyclonal antibody for detection of acetyl-Histone H3 (Lys14) also known as H3K14Ac, Histone H3 (acetyl K14) & has been validated in ChIP, WB, ChIP-seq, DB, Mplex. pricing
MABE351 Anti-acetyl-Histone H3 (Lys14) Antibody, clone 13HH3-1A5 Anti-acetyl-Histone H3 (Lys14) Antibody, clone 13HH3-1A5 is a mouse monoclonal antibody for detection of acetyl-Histone H3 (Lys14) also known as Histone H3.1t, H3/t, H3t, H3/g & has been validated in WB, IP, ICC. pricing
07-354 Anti-acetyl-Histone H3 (Lys18) Antibody Use Anti-acetyl-Histone H3 (Lys18) Antibody (Rabbit Polyclonal Antibody) validated in ChIP, WB to detect acetyl-Histone H3 (Lys18) also known as H3K18Ac, Histone H3 (acetyl K18). pricing
07-354-S Anti-acetyl-Histone H3 (Lys18) Antibody, Trial Size Use Anti-acetyl-Histone H3 (Lys18) Antibody (Rabbit Polyclonal Antibody), Trial Size / Pack validated in ChIP, WB to detect acetyl-Histone H3 (Lys18) also known as H3K18Ac, Histone H3 (acetyl K18). pricing
07-355 Anti-acetyl-Histone H3 (Lys23) Antibody Use Anti-acetyl-Histone H3 (Lys23) Antibody (Rabbit Polyclonal Antibody) validated in ChIP, WB to detect acetyl-Histone H3 (Lys23) also known as H3K23Ac, Histone H3 (acetyl K23). pricing
07-355-S Anti-acetyl-Histone H3 (Lys23) Antibody, Trial Size Use Anti-acetyl-Histone H3 (Lys23) Antibody (Rabbit Polyclonal Antibody), Trial Size / Pack validated in ChIP, WB to detect acetyl-Histone H3 (Lys23) also known as H3K23Ac, Histone H3 (acetyl K23). pricing
07-360 Anti-acetyl-Histone H3 (Lys27) Antibody Anti-acetyl-Histone H3 (Lys27) Antibody is a rabbit polyclonal antibody for detection of Histone H3 acetylated on lysine 27. Also known as Anti-H3K27ac this antibody is published in peer reviewed journals and is specificity verified by dot blot (DB) and validated in ChIP, ChIP-seq, WB, DB, Mplex. pricing
MABE670 Anti-Acetyl Histone H3 (Lys27) Antibody, clone 5E2.2 Acetyl Histone H3 (Lys27) Antibody, clone 5E2.2, Cat. No. MABE670, is a highly specific mouse monoclonal antibody, that targets Acetyl Histone H3 (Lys27) and has been tested in Western Blotting and Immunocytochemistry and Dot Blot. pricing
07-360-S Anti-acetyl-Histone H3 (Lys27) Antibody, Trial Size Anti-acetyl-Histone H3 (Lys27) Antibody is a Rabbit Polyclonal Antibody for detection of Histone H3 acetylated at lysine 27 (H3K27ac). This antibody has dot blot verified specificity and has been validated in ChIP, WB & Mplex. pricing
07-539-AF488 Anti-acetyl-Histone H3 (Lys4) Antibody, Alexa Fluor® 488 conjugate Anti-acetyl-Histone H3 (Lys4) Antibody, Alexa Fluor® 488 conjugate is an antibody against histone Lys4 acetylation for use in Immunocytochemistry. pricing
ABE18-AF488 Anti-acetyl Histone H3 (Lys9), Alexa Fluor® 488 Conjugate Antibody This Anti-acetyl Histone H3 (Lys9) is validated for use in Immunocytochemistry for the detection of acetyl Histone H3 (Lys9). pricing
06-942 Anti-acetyl-Histone H3 (Lys9) Antibody Anti-acetyl-Histone H3 (Lys9) Antibody is a Rabbit Polyclonal Antibody for detection of Histone H3 acetylated on lysine 9. This purified Ab, also known as Anti-H3K9Ac, is specificity verified by dot blot (DB), published in peer reviewed journals, and validated in WB, ChIP, ChIP-seq, FC. pricing
07-352 Anti-acetyl-Histone H3 (Lys9) Antibody Anti-acetyl-Histone H3 (Lys9) Antibody is a Rabbit Polyclonal Antibody for detection of acetyl-Histone H3 (Lys9) also known as H3K9Ac, Histone H3 (acetyl K9) and has been published and validated in ChIP, WB, Mplex. pricing
ABE18 Anti-acetyl Histone H3 (Lys9) Antibody Anti-acetyl Histone H3 (Lys9) Antibody is a rabbit polyclonal antibody for detection of Histone H3 acetylated at lysine 9. This purified antibody, also known as Anti-H4K9ac has dot blot (DB) proven specificity and has been validated in WB, DB, ChIP, Mplex. pricing
06-942-S Anti-acetyl-Histone H3 (Lys9) Antibody, Trial Size Anti-acetyl-Histone H3 (Lys9) Antibody, Trial Size is a Rabbit Polyclonal Antibody for detection of Histone H3 acetylated on lysine 9 (H3K9ac). This purified Ab is specificity verified by dot blot (DB) and validated in WB, ChIP, ChIP-seq, FC. Small pack size is ideal for screening applications. pricing
ABE18-S Anti-acetyl Histone H3 (Lys9) Antibody, Trial Size Anti-acetyl Histone H3 (Lys9) Antibody, Trial Size is a rabbit polyclonal for detection of Histone H3 acetylated at lysine 9. Also known as Anti-H3K9ac, this antibody has dot blot (DB) proven specificity and has been validated in WB, ChIP, Mplex. Small pack size is ideal for screening applications pricing
07-369-I Anti-dimethyl Histone H3 Antibody (Lys36) Anti-dimethyl Histone H3 Antibody (Lys36) is a highly specific rabbit polyclonal antibody, that targets Histone H3 & has been tested in western blotting, Dot Blot & Chromatin IP (ChIP). pricing
07-030-AF647 Anti-dimethyl Histone H3 Antibody (Lys4), Alexa Fluor® 647 Conjugate This Anti-dimethyl Histone H3 Antibody (Lys4), Alexa Fluor® 647 Conjugate is validated for use in Immunocytochemistry for the detection of dimethyl Histone H3. pricing
07-214 Anti-dimethyl-Histone H3 (Arg17) Antibody Anti-dimethyl-Histone H3 (Arg17) Antibody is a Rabbit Polyclonal Antibody for detection of dimethyl-Histone H3 (Arg17) also known as H3R17me2, Histone H3 (di methyl R17) & has been validated in ELISA, ICC peptide inhibition & WB. pricing
05-808 Anti-dimethyl-Histone H3 (Arg2) Antibody, rabbit monoclonal Use Anti-dimethyl-Histone H3 (Arg2) Antibody (Rabbit Monoclonal Antibody) validated in DB, WB, PIA, Mplex to detect dimethyl-Histone H3 (Arg2) also known as H3R2me2, Histone H3 (di methyl R2). pricing
04-808 Anti-dimethyl-Histone H3 (Arg2), clone 20.2 Antibody, rabbit monoclonal Use Anti-dimethyl-Histone H3 (Arg2), clone 20.2 Antibody (rabbit monoclonal antibody) validated in DB, Mplex, PIA, WB to detect dimethyl-Histone H3 (Arg2) also known as H3R2me2, Histone H3 (di methyl R2). pricing
04-808-S Anti-dimethyl-Histone H3 (Arg2), clone 20.2 Antibody, Trial Size Use Anti-dimethyl-Histone H3 (Arg2), clone 20.2 Antibody (rabbit monoclonal antibody) validated in DB, Mplex, PIA, WB to detect dimethyl-Histone H3 (Arg2) also known as H3R2me2, Histone H3 (di methyl R2). pricing
07-215 Anti-dimethyl-Histone H3 (Arg26) Antibody Anti-dimethyl-Histone H3 (Arg26) Antibody is a rabbit polyclonal antibody for detection of dimethyl-Histone H3 (Arg26) also known as H3R26me2, Histone H3 (di methyl R26) & has been validated in WB, Mplex. pricing
07-421-I Anti-dimethyl Histone H3 (Lys27) Anti-dimethyl Histone H3 (Lys27) Antibody, Cat. No. 07-421-I, is a highly specific chicken polyclonal antibody that targets histone H3 Lys27 dimethylation (H3K27me2) and has been tested in Dot Blot, Chromatin Immunoprecipitation, and Western Blotting. pricing
07-452 Anti-dimethyl-Histone H3 (Lys27) Antibody Use Anti-dimethyl-Histone H3 (Lys27) Antibody (rabbit polyclonal antibody) validated in Mplex, PIA, WB, ChIP-seq, DB to detect dimethyl-Histone H3 (Lys27) also known as H3K27me2, Histone H3 (di methyl K27). pricing
07-274 Anti-dimethyl-Histone H3 (Lys36) Antibody Use Anti-dimethyl-Histone H3 (Lys36) Antibody (Rabbit Polyclonal Antibody) validated in WB, DB to detect dimethyl-Histone H3 (Lys36) also known as H3K36me2, Histone H3 (di methyl K36). pricing
07-030 Anti-dimethyl-Histone H3 (Lys4) Antibody Use Anti-dimethyl-Histone H3 (Lys4) Antibody (rabbit polyclonal antibody) is published and validated in ChIP, DB, ICC, IF, WB, PIA, ChIP-seq. to detect dimethyl-Histone H3 (Lys4) also known as H3K4me2, Histone H3 (di methyl K4). pricing
ABE250 Anti-dimethyl Histone H3 (Lys4) Antibody Anti-dimethyl Histone H3 (Lys4) Antibody is a Rabbit Polyclonal Antibody for detection of Histone H3 dimethylated at lysine 4. This purified polyclonal antibody, also known as H3K4me2, has dot blot (DB) proven specificity & has been validated in WB, ICC, ChIP. pricing
07-030-AF488 Anti-dimethyl-Histone H3 (Lys4) Antibody, Alexa Fluor® 488 conjugate Anti-dimethyl-Histone H3 (Lys4) Antibody, Alexa Fluor® 488 conjugate is an antibody against histone Lys4 dimethylation for use in Immunocytochemistry. pricing
07-030-AF555 Anti-dimethyl Histone H3 (Lys4) Antibody, Alexa Fluor® 555 Conjugate This Anti-dimethyl Histone H3 (Lys4) Antibody, Alexa Fluor® 555 Conjugate is validated for use in Immunocytochemistry for the detection of dimethyl Histone H3. pricing
04-790 Anti-dimethyl-Histone H3 (Lys4) Antibody, clone AW30, rabbit monoclonal Anti-dimethyl-Histone H3 (Lys4) Antibody, clone AW30 is a rabbit monoclonal antibody for detection of dimethyl-Histone H3 (Lys4) also known as H3K4me2, Histone H3 (di methyl K4) & has been validated in WB, ChIP, ChIP-seq, DB, PIA, Mplex. pricing
04-790-S Anti-dimethyl-Histone H3 (Lys4) Antibody, clone AW30, Trial Size Anti-dimethyl-Histone H3 (Lys4) Antibody, clone AW30 is a rabbit monoclonal antibody for detection of dimethyl-Histone H3 (Lys4) also known as H3K4me2, Histone H3 (di methyl K4) & has been validated in WB, ChIP, ChIP-seq, DB, PIA, Mplex. pricing
ABE250-S Anti-dimethyl Histone H3 (Lys4) Antibody, Trial Size Anti-dimethyl Histone H3 (Lys4) Antibody, Trial Size is a Rabbit Polyclonal for detection of Histone H3 dimethylated at lysine 4. Also known as H3K4me2, this Ab has dot blot (DB) proven specificity & has been validated in WB, ICC, ChIP. Small pack size is ideal for screening applications. pricing
07-212 Anti-dimethyl-Histone H3 (Lys9) Antibody Anti-dimethyl-Histone H3 (Lys9) Antibody is a Rabbit Polyclonal Antibody for detection of dimethyl-Histone H3 (Lys9) also known as H3K9me2, Histone H3 (di methyl K9) & has been validated in ICC & WB. pricing
07-441 Anti-dimethyl-Histone H3 (Lys9) Antibody Use Anti-dimethyl-Histone H3 (Lys9) Antibody (Rabbit Polyclonal Antibody) validated in DB, ICC, PIA, WB to detect dimethyl-Histone H3 (Lys9) also known as H3K9me2, Histone H3 (di methyl K9). pricing
07-441-AF488 Anti-dimethyl-Histone H3 (Lys9) Antibody, AlexaFluor® 488 Conjugate Anti-dimethyl-Histone H3 (Lys9) Antibody, AlexaFluor® 488 Conjugate is an antibody against dimethyl-Histone H3 (Lys9) Antibody for use in Immunocytochemistry. pricing
04-768 Anti-dimethyl-Histone H3 (Lys9) Antibody, clone MC554, rabbit monoclonal Anti-dimethyl-Histone H3 (Lys9) Antibody, clone MC554 is a rabbit monoclonal antibody for detection of dimethyl-Histone H3 (Lys9) also known as H3K4me2, Histone H3 (di methyl K4) & has been validated in IF, WB, PIA, DB. pricing
05-768R Anti-dimethyl-Histone H3 (Lys9) Antibody, rabbit monoclonal Use Anti-dimethyl-Histone H3 (Lys9) Antibody (Rabbit Monoclonal Antibody) validated in WB, PIA to detect dimethyl-Histone H3 (Lys9) also known as H3K9me2, Histone H3 (di methyl K9). pricing
06-755 Anti-Histone H3 Antibody Anti-Histone H3 Antibody is a Rabbit Polyclonal Antibody for detection of Histone H3 also known as histone 3-H3 & has been validated in ChIP, ICC & WB. pricing
07-690 Anti-Histone H3 Antibody, CT, pan Use Anti-Histone H3 Antibody, CT, pan (rabbit polyclonal antibody) validated in ChIP, WB to detect Histone H3 also known as H3, Histone H3, H3 histone family member T, histone 3 H3, histone cluster 3 H3. pricing
04-791 Anti-mono/di/trimethyl-Histone H3 (Lys4) Antibody, clone AW304 | 04-791 pricing
ABE244 Anti-monomethyl-Histone H3 Antibody (Lys36) Anti-monomethyl-Histone H3 (Lys36) Antibody is a rabbit polyclonal antibody for detection of Histone H3 monomethylated at lysine 36. This purified polyclonal antibody also known as Anti-H3K36me1, has dot blot (DB) proven specificity & has been validated in WB, IP. pricing
07-448 Anti-monomethyl-Histone H3 (Lys27) Antibody Anti-monomethyl-Histone H3 (Lys27) Antibody is a rabbit polyclonal antibody to detect Histone H3 monomethylated at lysine 27. This purified Ab, also known as Anti-H3K27me1 is specificity verified by dot blot (DB), published in peer reviewed journals and validated in ICC, WB, ChIP, ChIP-seq. pricing
07-448-S Anti-monomethyl-Histone H3 (Lys27) Antibody, Trial Size Anti-monomethyl-Histone H3 (Lys27), Trial Size Antibody is a Rabbit Polyclonal Antibody for detection of Histone H3 monomethylated on lysine 27 (H3K27me1). This antibody has dot blot (DB) verified specificity and is validated in, ICC, WB, ChIP, ChIP-seq. Small pack size is ideal for screening. pricing
ABE244-S Anti-monomethyl-Histone H3 (Lys36) Antibody, Trial Size Anti-monomethyl-Histone H3 (Lys36) Antibody Trial Size is a rabbit polyclonal for detection of Histone H3 monomethylated at lysine 36. Also known as Anti-H3K36me1, this antibody has dot blot (DB) proven specificity & has been validated in WB, IP. Small pack size is ideal for screening applications. pricing
07-436 Anti-monomethyl-Histone H3 (Lys4) Antibody Anti-monomethyl-Histone H3 (Lys4) Antibody is a rabbit polyclonal antibody for detection of monomethyl-Histone H3 (Lys4) also known as H3K4me1, Histone H3 (mono methyl K4) & has been validated in ICC, IF, PIA, WB, ChIP-seq, DB. pricing
07-436-AF488 Anti-monomethyl Histone H3 (Lys4) Antibody, Alexa Fluor® 488 Conjugate This Anti-monomethyl Histone H3 (Lys4) Antibody, Alexa Fluor® 488 Conjugate is validated for use in ICC for the detection of monomethyl Histone H3 (Lys4). pricing
ABE1015 Anti-monomethyl-Histone H3 (Lys79) Antibody Detect Histone H3 using this rabbit polyclonal antibody, Anti-monomethyl-Histone H3 (Lys79) Antibody validated for use in western blotting, Dot Blot & ChIP-seq. pricing
ABE213 Anti-monomethyl-Histone H3 (Lys79) Antibody Use Anti-monomethyl-Histone H3 (Lys79) Antibody (Rabbit Polyclonal Antibody) validated in WB, DB, PIA, IP to detect monomethyl-Histone H3 (Lys79) also known as H3K79me1, Histone H3 (mono methyl K79). pricing
06-1416 Anti-monomethyl-Histone H3 (Lys9) Antibody Anti-monomethyl-Histone H3 (Lys9) Antibody is a rabbit polyclonal antibody for detection of monomethyl-Histone H3 (Lys9) also known as H3K9me1, Histone H3 (mono methyl K9), H3me3K9 & has been validated in WB, ICC, PIA. pricing
07-395 Anti-monomethyl-Histone H3 (Lys9) Antibody Use Anti-monomethyl-Histone H3 (Lys9) Antibody (Rabbit Polyclonal Antibody) validated in WB to detect monomethyl-Histone H3 (Lys9) also known as H3K9me1, Histone H3 (mono methyl K9). pricing
07-450 Anti-monomethyl-Histone H3 (Lys9) Antibody Anti-monomethyl-Histone H3 (Lys9) Antibody is a Rabbit Polyclonal Antibody for detection of Histone H3 monomethylated on lysine 9 (H3K9me1). This purified antibody is specificity verified by dot blot (DB), published in peer reviewed journals, and has been validated in ICC, PIA & WB. pricing
ABE101 Anti-monomethyl-Histone H3 (Lys9) Antibody Anti-monomethyl-Histone H3 (Lys9) Antibody is a Rabbit Polyclonal Antibody for detection of Histone H3 monomethylated on lysine 9. This purified Ab, also known as Anti-H3K9me1 has dot blot proven specificity and is validated in WB, ICC, PIA. pricing
07-450-S Anti-monomethyl-Histone H3 (Lys9) Antibody, Trial Size Anti-monomethyl-Histone H3 (Lys9) Antibody, Trial Size is a purified rabbit polyclonal that detects Histone H3 monomethylated on lysine 9 (H3K9me1). This Ab is specificity verified by dot blot (DB), and validated in ICC, PIA, WB. The small pack size is ideal for screening applications. pricing
ABE101-S Anti-monomethyl-Histone H3 (Lys9) Antibody, Trial Size Anti-monomethyl-Histone H3 (Lys9) Antibody, Trial Size is a rabbit polyclonal for detection of Histone H3 monomethylated on lysine 9. Also known as H3K9me1, this antibody has dot blot proven specificity, and has been validated in WB, ICC, PIA. Small pack size is ideal for screening. pricing
06-570-AF555 Anti-phospho-H3 Antibody (Ser10), Alexa Fluor® 555 Conjugate Anti-phospho-H3 (Ser10), Alexa Fluor® 555 Conjugate is a purified rabbit polyclonal Antibody that detects Histone H3 phosphorylated at serine 10. This Ab is labeled with Alexa Fluor 555 and validated for use in IC. The unconjugated version of this antibody is published & proven in ICC, IP & WB. pricing
FCMAB104A4 Anti-phospho H3 (Ser10) Antibody, clone 3H10 Alexa Fluor® 488 Anti-Phospho-Histone H3 (Ser10) Antibody, clone 3H10, Alexa Fluor® 488, is a Mouse Monoclonal Antibody for detection of Histone H3 phosphorylated at serine 10. This purified mAb, also known as H3S10p,
is labeled with Alexa Fluor® 488 and validated for use in FC.
pricing
06-570-AF647 Anti-phospho Histone H3 (Ser10), Alexa Fluor® 647 Conjugate Antibody Anti-phospho-H3 (Ser10), Alexa Fluor® 647 Conjugate is a purified rabbit polyclonal antibody to detect Histone H3 phosphorylated at serine 10. This Ab is labeled with Alexa Fluor 647 and validated for use in IC. The unconjugated version of this antibody is published and proven in ICC, IP & WB. pricing
06-570-AF488 Anti-phospho Histone H3 (Ser10) Antibody, Alexa Fluor® 488 Conjugate Anti-phospho-H3 (Ser10), Alexa Fluor® 488 Conjugate is a purified rabbit polyclonal that detects Histone H3 phosphorylated at serine 10. This Ab is labeled with Alexa Fluor 488 and validated in IC. The unconjugated version of this antibody is highly published and proven in ICC, IP & WB. pricing
16-189 Anti-phospho-Histone H3 (Ser10) Antibody, biotin conjugate Anti-phospho-Histone H3 (Ser10) Antibody, biotin conjugate is a Rabbit Polyclonal Antibody for detection of Histone H3 phosphorylated at serine 10. This purified mAb, also known as H3S10p,is biotinylated, published in peer reviewed journals and has been validated in WB, ICC. pricing
05-806 Anti-phospho-Histone H3 (Ser10) Antibody, clone 3H10 Anti-phospho-Histone H3 (Ser10) Antibody, clone 3H10 is a mouse monoclonal antibody for detection of Histone H3 phosphorylated at serine 10. This purified mAb, also known as H3S10p, is published in peer reviewed journals and has been validated in FC, ICC, IF, PIA, WB, Mplex. pricing
05-806-AF555 Anti-phospho-Histone H3 (Ser10) Antibody, clone 3H10, Alexa Fluor® 555 Anti-phospho-Histone H3 (Ser10) Antibody, clone 3H10, Alexa Fluor® 555 is an antibody against phospho-Histone H3 for use in Immunocytochemistry. pricing
16-218 Anti-Phospho-Histone H3 (Ser10) Antibody, clone 3H10, Cy5 conjugate Anti-Phospho-Histone H3 (Ser10) Antibody, clone 3H10, Cy5 Conjugate is a Mouse Monoclonal Antibody for detection of Histone H3 phosphorylated at serine 10. This purified mAb, also known as H3S10p,
is labeled with Cy5.5 NHS ester (Cy5), and validated in IF, WB.
pricing
16-222 Anti-Phospho-Histone H3 (Ser10) Antibody, clone 3H10, FITC Conjugate Anti-Phospho-Histone H3 (Ser10) Antibody, clone 3H10, FITC Conjugate is a Mouse Monoclonal for detection of Histone H3 phosphorylated at serine 10. This mAb, also known as H3S10p,is labeled with Fluorescein isothiocyanate (FITC), published in peer reviewed journals & validated in WB, ICC & IF. pricing
05-817R-I Anti-phospho-Histone H3 (Ser10) Antibody, clone 63-1C-8, Recombinant Anti-phospho-Histone H3 (Ser10) Antibody, clone 63-1C-8, is a recombinant rabbit monoclonal antibody that detects Histone H3 phosphorylated at serine 10. This purified recombinant mAb, also known as Anti-H3S10p, is published and validated in WB, Flow Cytometry, and is specificity verified by DB. pricing
04-817 Anti-phospho-Histone H3 (Ser10) Antibody, clone MC463, rabbit monoclonal Anti-phospho-Histone H3 (Ser10) Antibody, clone MC463 is a rabbit monoclonal antibody for detection of Histone H3 phosphorylated at serine 10. This mAb, also known as H3S10p, is specificity verified using DB & Mplex, published in peer reviewed journals & validated in ChIP, IF, WB, ICC, ChIP-seq. pricing
05-598 Anti-phospho-Histone H3 (Ser10) Antibody, clone RR002 Anti-phospho-Histone H3 (Ser10) Antibody, clone RR002 is a Mouse Monoclonal Antibody for detection of Histone H3 phosphorylated at serine 10. This purified mAb, also known as Anti-H3S10p, is published in peer reviewed journals and is validated in ICC, IHC, WB. pricing
06-570 Anti-phospho-Histone H3 (Ser10) Antibody, Mitosis Marker Anti-phospho-Histone H3 (Ser10) Antibody, Mitosis Marker is a Rabbit Polyclonal Antibody for detection of Histone H3 phosphorylated at serine 10.This highly published Ab, also known as Anti-H3S10p, has been validated in ICC, IP & WB. pricing
05-806-AF647 Anti-phospho Histone H3 (Ser10), clone 3H10, Alexa Fluor® 647 Antibody This Anti-phospho Histone H3 (Ser10) antibody, clone 3H10, Alexa Fluor® 647 is a purified mouse monoclonal for detection of Histone H3 phosphorylated at serine 10.
This mAb is fluorescently labeled and validated for use in IC. The unconjugated version has been proven in FC, ICC, IF, PIA, WB, Mplex.
pricing
07-145 Anti-phospho-Histone H3 (Ser28) Antibody Use Anti-phospho-Histone H3 (Ser28) Antibody (Rabbit Polyclonal Antibody) validated in WB, ICC, DB, PIA, ChIP to detect phospho-Histone H3 (Ser28) also known as H3F3, H3F3B, H3S28P. pricing
04-789 Anti-phospho-Histone H3 (Thr11) Antibody, clone MC83, rabbit monoclonal Anti-phospho-Histone H3 (Thr11) Antibody, clone MC83 is a rabbit monoclonal antibody for detection of phospho-Histone H3 (Thr11) also known as H3T11P, Histone H3 (phospho T11) & has been validated in WB, PIA, Mplex. pricing
07-424 Anti-phospho-Histone H3 (Thr3) Antibody Anti-phospho-Histone H3 (Thr3) Antibody is a Rabbit Polyclonal Antibody for detection of phospho-Histone H3 (Thr3) also known as H3T3P, Histone H3 (phospho T3) & has been validated in IF, WB, ICC. pricing
04-746 Anti-phospho-Histone H3 (Thr3) Antibody, clone JY325, rabbit monoclonal Use Anti-phospho-Histone H3 (Thr3) Antibody, clone JY325 (Rabbit Monoclonal Antibody) validated in WB, DB, Mplex, PIA to detect phospho-Histone H3 (Thr3) also known as H3T3P, Histone H3 (phospho T3). pricing
07-081 Anti-phospho (Ser10)-acetyl (Lys14)-Histone H3 Antibody Anti-phospho (Ser10)-acetyl (Lys14)-Histone H3, Cat. No. 07-081, is a highly specific rabbit polyclonal antibody that targets Histone H3 phosphorylated on Serine 10 and acetylated on Lysine 14 and has been tested for use in Immunocytochemistry, Peptide Inhibition Assay, ChIP-seq and Chromatin Immuno pricing
05-1315 Anti-phospho (Ser10) acetyl (Lys14) Histone H3 Antibody, clone 10H10.2 Use Anti-phospho (Ser10) acetyl (Lys14) Histone H3 Antibody, clone 10H10.2 (Mouse Monoclonal Antibody) validated in WB to detect phospho (Ser10) acetyl (Lys14) Histone H3 also known as H3S10PK14Ac. pricing
07-449-AF555 Anti-trimethyl Histone H3 (Lys27), Alexa Fluor® 555 Conjugate Antibody This Anti-trimethyl Histone H3 (Lys27) is validated for use in Immunocytochemistry for the detection of trimethyl Histone H3 (Lys27). pricing
07-449-AF647 Anti-trimethyl Histone H3 (Lys27), Alexa Fluor® 647 Conjugate Antibody This Anti-trimethyl Histone H3 (Lys27) antibody is validated for use in ICC for the detection of trimethyl Histone H3 (Lys27). pricing
07-449 Anti-trimethyl-Histone H3 (Lys27) Antibody Anti-trimethyl-Histone H3 (Lys27), also known as Anti-H3K27me3, is a highly published Rabbit Polyclonal Antibody. This protein A purified antibody is dot blot tested for trimethylated lysine 27 specificity and validated in WB, ICC, IP. pricing
ABE44 Anti-trimethyl Histone H3 (Lys27) Antibody Anti-trimethyl Histone H3 (Lys27) Antibody is a rabbit polyclonal antibody for detection of Histone H3 trimethylated on lysine 27( H3K27me3). This purified polyclonal is specificity verified by dot blot (DB), published in peer reviewed journals and validated in WB, ICC, PIA. pricing
07-449-AF488 Anti-trimethyl-Histone H3 (Lys27) Antibody, Alexa Fluor® 488 Conjugate This Anti-trimethyl-Histone H3 (Lys27) Antibody, Alexa Fluor® 488 Conjugate is validated for use in Immunocytochemistry for the detection of trimethyl-Histone H3. pricing
05-1951 Anti-trimethyl Histone H3 (Lys27) Antibody, clone 18E9.1 Anti-trimethyl Histone H3 (Lys27) Antibody, clone 18E9.1 is a mouse monoclonal antibody for detection of trimethyl Histone H3 (Lys27) also known as H3K27me3, Histone H3 (tri methyl K27) & has been validated in WB, ICC. pricing
05-1951-S Anti-trimethyl Histone H3 (Lys27) Antibody, clone 18E9.1, Trial Size Anti-trimethyl Histone H3 (Lys27) Antibody, clone 18E9.1, Trial Size / Pack is a mouse monoclonal antibody for detection of trimethyl Histone H3 (Lys27) also known as H3K27me3, Histone H3 (tri methyl K27) & has been validated in WB, ICC. pricing
ABE44-S Anti-trimethyl Histone H3 (Lys27) Antibody, Trial Size Anti-trimethyl Histone H3 (Lys27) Antibody is a rabbit polyclonal antibody for detection of Histone H3 trimethylated on lysine 27 (H3K73me). This purified Ab is specificity verified by dot blot (DB) & validated in WB, ICC, PIA. Small pack size is ideal for screening applications. pricing
ABE435 Anti-trimethyl-Histone H3 (Lys36) Antibody Anti-trimethyl-Histone H3 (Lys36) Antibody is a rabbit polyclonal antibody for detection of Histone H3 trimethylated at lysine 36. Also known as Anti-H3K36me3, this purified Ab is specificity verified by dot blot (DB) and has been validated in WB, ICC, DB, ChIP, ChIP-seq. pricing
05-801 Anti-trimethyl-Histone H3 (Lys36) Antibody, clone MC86, rabbit monoclonal Use Anti-trimethyl-Histone H3 (Lys36) Antibody, clone MC86 (rabbit monoclonal antibody) validated in DB, WB, PIA to detect trimethyl-Histone H3 (Lys36) also known as H3K36me3, Histone H3 (tri methyl K36). pricing
ABE435-S Anti-trimethyl-Histone H3 (Lys36) Antibody, Trial Size Anti-trimethyl-Histone H3 (Lys36) Antibody, Trial Size, is a rabbit polyclonal antibody for detection of Histone H3 trimethylated at lysine 36 (H3K36me3). This purified Ab is specificity verified by dot blot (DB) and validated in WB, ICC. Small pack size is ideal for screening applications. pricing
07-473 Anti-trimethyl-Histone H3 (Lys4) Antibody Anti-trimethyl-Histone H3 (Lys4) Antibody is a rabbit polyclonal antibody for detection of Histone H3 trimethylated at lysine 4. Also known as Anti-H3K4me3, this highly specific and well published antibody has been validated in ChIP, DB, WB, PIA, ChIP-seq. pricing
07-473-AF488 Anti-trimethyl-Histone H3 (Lys4) Antibody, Alexa Fluor® 488 Conjugate This Anti-trimethyl-Histone H3 (Lys4) Antibody, Alexa Fluor® 488 Conjugate is validated for use in Immunocytochemistry for the detection of trimethyl-Histone H3. pricing
07-473-AF555 Anti-trimethyl Histone H3 (Lys4) Antibody, Alexa Fluor® 555 Conjugate This Anti-trimethyl Histone H3 (Lys4) Antibody, Alexa Fluor® 555 Conjugate is validated for use in Immunocytochemistry for the detection of trimethyl Histone H3. pricing
07-473-AF647 Anti-trimethyl-Histone H3 (Lys4) Antibody, Alexa Fluor® 647 Conjugate This Anti-trimethyl-Histone H3 (Lys4) Antibody, Alexa Fluor® 647 Conjugate is validated for use in Immunocytochemistry for the detection of trimethyl-Histone H3. pricing
04-745 Anti-trimethyl-Histone H3 (Lys4) Antibody, clone MC315, rabbit monoclonal Anti-trimethyl-Histone H3 (Lys4) Antibody, clone MC315 is a rabbit monoclonal antibody for detection of trimethyl-Histone H3 (Lys4) also known as H3K4me3, Histone H3 (tri methyl K4) & has been validated in WB, ChIP, DB, Mplex, ChIP-seq. pricing
07-992 Anti-trimethyl Histone H3 (Lys4/Lys9) Antibody Use Anti-trimethyl Histone H3 (Lys4/Lys9) Antibody (Rabbit Polyclonal Antibody) validated in WB, ICC to detect trimethyl Histone H3 (Lys4/Lys9) also known as H3K4/9me3, Histone H3 (tri methyl K4/9). pricing
07-952 Anti-trimethyl Histone H3 (Lys79) Antibody Anti-trimethyl Histone H3 (Lys79) Antibody is a rabbit polyclonal antibody for detection of trimethyl Histone H3 (Lys79). It has been tested for use in Western blotting, Dot blots, and Multiplex assays. pricing
07-952-S Anti-trimethyl Histone H3 (Lys79) Antibody, Trial Size Anti-trimethyl Histone H3 (Lys79) Antibody is a rabbit polyclonal antibody for detection of trimethyl Histone H3 (Lys79) also known as H3K79me2, Histone H3 (di methyl K79) & has been validated in WB, Mplex. pricing
07-442 Anti-trimethyl-Histone H3 (Lys9) Antibody Use Anti-trimethyl-Histone H3 (Lys9) Antibody (rabbit polyclonal antibody) validated in DB, ICC, Mplex, PIA, WB, ChIP-seq to detect trimethyl-Histone H3 (Lys9) also known as H3K9me3, Histone H3 (tri methyl K9). pricing
07-442-AF488 Anti-trimethyl Histone H3 (Lys9) Antibody, Alexa Fluor® 488 Conjugate This Anti-trimethyl Histone H3 (Lys9) Antibody, Alexa Fluor® 488 Conjugate is validated for use in ICC for the detection of trimethyl Histone H3 (Lys9). pricing
05-809 Anti-trimethyl (Lys9)-phospho (Ser10)-Histone H3 Antibody, rabbit monoclonal Anti-trimethyl (Lys9)-phospho (Ser10)-Histone H3 Antibody is a rabbit monoclonal antibody for detection of trimethyl (Lys9)-phospho (Ser10)-Histone H3 also known as H3K9me3S10P, has been validated in WB, PIA, Mplex. pricing
17-10111 ChIPAb+™ Acetyl-Histone H3 (Lys18) - ChIP Validated Antibody and Primer Set This ChIPAb+ Acetyl-Histone H3 (Lys18) -ChIP Validated Antibody & Primer Set conveniently includes the antibody & the specific control PCR primers. pricing
17-10112 ChIPAb+™ Acetyl Histone H3 (Lys23) - ChIP Validated Antibody and Primer Set This ChIPAb+ Acetyl Histone H3 (Lys23) -ChIP Validated Antibody & Primer Set conveniently includes the antibody & the specific control PCR primers. pricing
17-10254 ChIPAb+™ Histone H3 (CT) - ChIP Validated Antibody and Primer Set This ChIPAb+ Histone H3 (C-Term) -ChIP Validated Antibody & Primer Set conveniently includes the antibody & the specific control PCR primers. pricing
17-675 ChIPAb+ Histone H3 (Unmodified Lys4) - ChIP Validated Antibody and Primer Set This ChIPAb+ Histone H3 (Unmodified Lys4) -ChIP Validated Antibody & Primer Set conveniently includes the antibody & the specific control PCR primers. pricing
17-10498 ChIPAb+ Monomethyl-Histone H3 (Lys36) - ChIP Validated Antibody and Primer Set The ChIPAb+ Monomethyl-Histone H3 (Lys36) set includes the monomethyl-Histone H3 (Lys36) antibody, a Normal Rabbit IgG & control primers which amplify a 213 bp region of the human GAPDH coding region. pricing
17-676 ChIPAb+ Monomethyl-Histone H3 (Lys4) - ChIP Validated Antibody and Primer Set This ChIPAb+ Monomethyl-Histone H3 (Lys4) -ChIP Validated Antibody & Primer Set conveniently includes the antibody & the specific control PCR primers. pricing
17-10269 ChIPAb+™ Phospho-Histone H3 (Ser28) Antibody This ChIPAb+ Phospho-Histone H3 (Ser28) -ChIP Validated Antibody & Primer Set conveniently includes the antibody & the specific control PCR primers. pricing
17-10139 ChIPAb+™ Phospho-Histone H3 (Thr11) - ChIP Validated Antibody and Primer Set This ChIPAb+ Phospho-Histone H3 (Thr11) -ChIP Validated Antibody & Primer Set conveniently includes the antibody & the specific control PCR primers. pricing
17-10141 ChIPAb+™ Phospho-Histone H3 (Thr3) - ChIP Validated Antibody and Primer Set, rabbit monoclonal This ChIPAb+ Phospho-Histone H3 (Thr3) -ChIP Validated Antibody & Primer Set conveniently includes the antibody & the specific control PCR primers. pricing
17-10130 ChIPAb+™ Trimethyl-Histone H3 (Lys79) - ChIP Validated Antibody and Primer Set This ChIPAb+ Trimethyl-Histone H3 (Lys79) -ChIP Validated Antibody & Primer Set conveniently includes the antibody & the specific control PCR primers. pricing
FCABS301A4 Milli-Mark™ Anti-dimethyl-Histone H3 (Lys9)-Alexa Fluor®488 Antibody Milli-Mark Anti-dimethyl-Histone H3 (Lys9)-Alexa Fluor®488 Antibody detects level of dimethyl-Histone H3 (Lys9)-Alexa Fluor®488 & has been published & validated for use in FC. pricing
FCABS304A4 Milli-Mark™ Anti-monomethyl-Histone H3 (Lys27)-Alexa Fluor® 488 Antibody Detect monomethyl-Histone H3 (Lys27) using this Milli-Mark Anti-monomethyl-Histone H3 (Lys27)-Alexa Fluor 488 Antibody validated for use in FC. pricing
FCABS384F Milli-Mark® Anti-monomethyl-Histone H3 (Lys9)-FITC Antibody Detect monomethyl-Histone H3 (Lys9) using this Milli-Mark Anti-monomethyl-Histone H3 (Lys9)-FITC Antibody validated for use in FC. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003493 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003493 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233164 predicted 202
2 SASI_Hs01_00233165 predicted 418
3 SASI_Hs01_00233166 predicted 411
4 SASI_Hs01_00233167 predicted 7
5 SASI_Hs01_00233168 predicted 426
6 SASI_Hs01_00233169 predicted 18
7 SASI_Hs01_00233170 predicted 74
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003493
HIST3H3 MISSION shRNA Bacterial Glycerol Stock
histone cluster 3, H3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003493.2-219s1c1
Sequence:CCGGCGAGATCGCTCAGGACTTTAACTCGAGTTAAAGTCCTGAGCGATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003493.2-168s1c1
Sequence:CCGGGAAGTCCACTGAGCTGCTAATCTCGAGATTAGCAGCTCAGTGGACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003493.2-177s1c1
Sequence:CCGGTGAGCTGCTAATCCGCAAGTTCTCGAGAACTTGCGGATTAGCAGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003493.2-213s1c1
Sequence:CCGGGATGCGCGAGATCGCTCAGGACTCGAGTCCTGAGCGATCTCGCGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003493.2-328s1c1
Sequence:CCGGCTGTGTGTCATCCATGCCAAACTCGAGTTTGGCATGGATGACACACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003493.2-312s21c1
Sequence:CCGGGTTTGAGGACACCAACCTGTGCTCGAGCACAGGTTGGTGTCCTCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003493.2-356s21c1
Sequence:CCGGCCATCATGCCTAAGGACATCCCTCGAGGGATGTCCTTAGGCATGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003493.2-185s21c1
Sequence:CCGGTAATCCGCAAGTTGCCCTTCCCTCGAGGGAAGGGCAACTTGCGGATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003493
HIST3H3 MISSION shRNA shRNA Plasmid DNA
histone cluster 3, H3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003493.2-219s1c1
Sequence:CCGGCGAGATCGCTCAGGACTTTAACTCGAGTTAAAGTCCTGAGCGATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003493.2-168s1c1
Sequence:CCGGGAAGTCCACTGAGCTGCTAATCTCGAGATTAGCAGCTCAGTGGACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003493.2-177s1c1
Sequence:CCGGTGAGCTGCTAATCCGCAAGTTCTCGAGAACTTGCGGATTAGCAGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003493.2-213s1c1
Sequence:CCGGGATGCGCGAGATCGCTCAGGACTCGAGTCCTGAGCGATCTCGCGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003493.2-328s1c1
Sequence:CCGGCTGTGTGTCATCCATGCCAAACTCGAGTTTGGCATGGATGACACACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003493.2-312s21c1
Sequence:CCGGGTTTGAGGACACCAACCTGTGCTCGAGCACAGGTTGGTGTCCTCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003493.2-356s21c1
Sequence:CCGGCCATCATGCCTAAGGACATCCCTCGAGGGATGTCCTTAGGCATGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003493.2-185s21c1
Sequence:CCGGTAATCCGCAAGTTGCCCTTCCCTCGAGGGAAGGGCAACTTGCGGATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003493
HIST3H3 MISSION shRNA Lentiviral Transduction Particles
histone cluster 3, H3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003493.2-219s1c1
Sequence:CCGGCGAGATCGCTCAGGACTTTAACTCGAGTTAAAGTCCTGAGCGATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003493.2-168s1c1
Sequence:CCGGGAAGTCCACTGAGCTGCTAATCTCGAGATTAGCAGCTCAGTGGACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003493.2-177s1c1
Sequence:CCGGTGAGCTGCTAATCCGCAAGTTCTCGAGAACTTGCGGATTAGCAGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003493.2-213s1c1
Sequence:CCGGGATGCGCGAGATCGCTCAGGACTCGAGTCCTGAGCGATCTCGCGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003493.2-328s1c1
Sequence:CCGGCTGTGTGTCATCCATGCCAAACTCGAGTTTGGCATGGATGACACACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003493.2-312s21c1
Sequence:CCGGGTTTGAGGACACCAACCTGTGCTCGAGCACAGGTTGGTGTCCTCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003493.2-356s21c1
Sequence:CCGGCCATCATGCCTAAGGACATCCCTCGAGGGATGTCCTTAGGCATGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003493.2-185s21c1
Sequence:CCGGTAATCCGCAAGTTGCCCTTCCCTCGAGGGAAGGGCAACTTGCGGATTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)