EMAIL THIS PAGE TO A FRIEND

HIST3H3

histone cluster 3, H3

31 Gene Product Result for
Synonyms: H3.4 H3/g H3FT H3t
UniProtKB ID: Q16695, B2R5K3, Q6FGU4
Gene ID:
Human(8290) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a member of the histone H3 family. Transcripts from this gene lack polyA tails; instead, they contain a palindromic termination element. This gene is located separately from the other H3 genes that are in the histone gene cluster on chromosome 6p22-p21.3. [provided by RefSeq, Jul 2008]
Rat(287352) histone cluster 3, H3
dog(480760) histone cluster 3, H3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
ZRB06599 Anti-Acetyl Histone H3 (Lys9 and 14) Antibody, clone 5H20, ZooMAb® Rabbit Monoclonal recombinant monoclonal antibody Antibody Enhanced Validation New human
immunocytochemistry, immunohistochemistry, inhibition assay, western blot pricing
H9161 Anti-acetyl- & phospho-Histone H3 (Ac-Lys9, pSer10) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution frog, bovine, human, mouse, Caenorhabditis elegans, Drosophila, rat, chicken
immunofluorescence, microarray, western blot pricing
SAB4200485 Anti-acetyl-Histone H3 (Ac-Lys27) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody mouse, human, rat
immunofluorescence, immunohistochemistry, western blot pricing
H9286 Anti-acetyl-Histone H3 (Ac-Lys9) antibody produced in rabbit 2-2.5 mg/mL, affinity isolated antibody, buffered aqueous solution Drosophila, human, bovine, frog, chicken, Caenorhabditis elegans, rat, mouse
immunofluorescence, microarray, western blot pricing
H0913 Anti-acetyl-Histone H3 (Ac-Lys9) antibody, Mouse monoclonal clone AH3-120, purified from hybridoma cell culture human, mouse, bovine, frog, chicken, rat, Caenorhabditis elegans, Drosophila
ELISA, immunocytochemistry, microarray, western blot pricing
SAB4200389 Anti-acetyl-Histone H3 [Ac-Lys23] antibody produced in rabbit IgG fraction of antiserum, antigen mol wt ~15 kDa human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB4200328 Anti-acetyl-Histone H3 [Ac-Lys56] IgG fraction of antiserum human, mouse, rat
western blot pricing
SAB4200353 Anti-acetyl-Histone H4 [Ac-Lys12] antibody produced in rabbit IgG fraction of antiserum mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
D5692 Anti-dimethyl-Histone H3 (diMe-Lys4) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution Caenorhabditis elegans, Arabidopsis thaliana, Drosophila, human, bovine, frog, rat, chicken, mouse
ChIP, microarray, western blot pricing
D5567 Anti-dimethyl-Histone H3 (diMe-Lys9) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution Arabidopsis thaliana, Drosophila, Caenorhabditis elegans, bovine, human, chicken, frog, rat, mouse
ChIP, microarray, western blot pricing
AV01011 Anti-H3F3A antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
H0164 Anti-Histone H3 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, plant, human, Drosophila, rat, chicken, Xenopus
immunofluorescence, western blot pricing
SAB4300869 Anti-Histone H4R3me1 antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunofluorescence, immunoprecipitation (IP), western blot pricing
M4819 Anti-methyl-Histone H3 (Me-Lys4) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution chicken, Caenorhabditis elegans, Drosophila, bovine, mouse, human, frog, Arabidopsis thaliana, rat
western blot pricing
H7162 Anti-methyl-Histone H3 (Me-Lys9) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution Caenorhabditis elegans, mouse, rat, bovine, chicken, frog, Drosophila, human
microarray, western blot pricing
H0412 Anti-phospho-Histone H3 (pSer10) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution frog, human, mouse, Drosophila, rat, Caenorhabditis elegans, bovine, chicken
immunofluorescence, microarray, western blot pricing
ZRB04791 Anti-trimethyl-Histone H3 (Lys4) Antibody, clone MC315, ZooMAb® Rabbit Monoclonal recombinant monoclonal antibody Antibody Enhanced Validation New human, mouse
immunocytochemistry, immunohistochemistry, inhibition assay, western blot pricing
SAB5100007 Imprint®ChIP-Validated Anti-Acetyl-Histone H3 (Ac-Lys9) (H3K9ac) antibody produced in rabbit affinity isolated antibody human
ChIP, western blot pricing
SAB5100009 Imprint ® ChiP-Validated Anti-methyl-Histone H3 (Me-Lys4) (H3K4me1) antibody produced in rabbit affinity isolated antibody chicken, frog, mouse, bovine, human
ChIP, western blot pricing
SAB5100008 Imprint® ChIP-Validated Anti-methyl-Histone H3 (Me-Lys9) (H3K9me1) affinity isolated antibody human
ChIP, western blot pricing
H0788 Monoclonal Anti-acetyl- & phospho-Histone H3 (Ac-Lys9, pSer10) antibody produced in mouse ~2 mg/mL, clone APH3-64, purified immunoglobulin, buffered aqueous solution frog, rat, Drosophila, Caenorhabditis elegans, human, mouse, bovine, chicken
ELISA, immunoprecipitation (IP), microarray, western blot pricing
H9908 Monoclonal Anti-phospho-Histone H3 (pSer28) antibody produced in rat ~0.5 mg/mL, clone HTA28, purified immunoglobulin, buffered aqueous solution human, bovine, hamster, mouse
flow cytometry, immunocytochemistry, microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003493 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003493 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003493 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003493 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003493 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233164 predicted 202
2 SASI_Hs01_00233165 predicted 418
3 SASI_Hs01_00233166 predicted 411
4 SASI_Hs01_00233167 predicted 7
5 SASI_Hs01_00233168 predicted 426
6 SASI_Hs01_00233169 predicted 18
7 SASI_Hs01_00233170 predicted 74
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003493
HIST3H3 MISSION shRNA Bacterial Glycerol Stock
histone cluster 3, H3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003493.2-213s1c1
Sequence:CCGGGATGCGCGAGATCGCTCAGGACTCGAGTCCTGAGCGATCTCGCGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003493.2-219s1c1
Sequence:CCGGCGAGATCGCTCAGGACTTTAACTCGAGTTAAAGTCCTGAGCGATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003493.2-168s1c1
Sequence:CCGGGAAGTCCACTGAGCTGCTAATCTCGAGATTAGCAGCTCAGTGGACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003493.2-328s1c1
Sequence:CCGGCTGTGTGTCATCCATGCCAAACTCGAGTTTGGCATGGATGACACACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003493.2-312s21c1
Sequence:CCGGGTTTGAGGACACCAACCTGTGCTCGAGCACAGGTTGGTGTCCTCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003493.2-177s1c1
Sequence:CCGGTGAGCTGCTAATCCGCAAGTTCTCGAGAACTTGCGGATTAGCAGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003493.2-356s21c1
Sequence:CCGGCCATCATGCCTAAGGACATCCCTCGAGGGATGTCCTTAGGCATGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003493.2-185s21c1
Sequence:CCGGTAATCCGCAAGTTGCCCTTCCCTCGAGGGAAGGGCAACTTGCGGATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003493
HIST3H3 MISSION shRNA shRNA Plasmid DNA
histone cluster 3, H3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003493.2-213s1c1
Sequence:CCGGGATGCGCGAGATCGCTCAGGACTCGAGTCCTGAGCGATCTCGCGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003493.2-219s1c1
Sequence:CCGGCGAGATCGCTCAGGACTTTAACTCGAGTTAAAGTCCTGAGCGATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003493.2-168s1c1
Sequence:CCGGGAAGTCCACTGAGCTGCTAATCTCGAGATTAGCAGCTCAGTGGACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003493.2-328s1c1
Sequence:CCGGCTGTGTGTCATCCATGCCAAACTCGAGTTTGGCATGGATGACACACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003493.2-312s21c1
Sequence:CCGGGTTTGAGGACACCAACCTGTGCTCGAGCACAGGTTGGTGTCCTCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003493.2-177s1c1
Sequence:CCGGTGAGCTGCTAATCCGCAAGTTCTCGAGAACTTGCGGATTAGCAGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003493.2-356s21c1
Sequence:CCGGCCATCATGCCTAAGGACATCCCTCGAGGGATGTCCTTAGGCATGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003493.2-185s21c1
Sequence:CCGGTAATCCGCAAGTTGCCCTTCCCTCGAGGGAAGGGCAACTTGCGGATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003493
HIST3H3 MISSION shRNA Lentiviral Transduction Particles
histone cluster 3, H3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003493.2-213s1c1
Sequence:CCGGGATGCGCGAGATCGCTCAGGACTCGAGTCCTGAGCGATCTCGCGCATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003493.2-219s1c1
Sequence:CCGGCGAGATCGCTCAGGACTTTAACTCGAGTTAAAGTCCTGAGCGATCTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003493.2-168s1c1
Sequence:CCGGGAAGTCCACTGAGCTGCTAATCTCGAGATTAGCAGCTCAGTGGACTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003493.2-328s1c1
Sequence:CCGGCTGTGTGTCATCCATGCCAAACTCGAGTTTGGCATGGATGACACACAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003493.2-312s21c1
Sequence:CCGGGTTTGAGGACACCAACCTGTGCTCGAGCACAGGTTGGTGTCCTCAAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003493.2-177s1c1
Sequence:CCGGTGAGCTGCTAATCCGCAAGTTCTCGAGAACTTGCGGATTAGCAGCTCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003493.2-356s21c1
Sequence:CCGGCCATCATGCCTAAGGACATCCCTCGAGGGATGTCCTTAGGCATGATGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003493.2-185s21c1
Sequence:CCGGTAATCCGCAAGTTGCCCTTCCCTCGAGGGAAGGGCAACTTGCGGATTATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)