EMAIL THIS PAGE TO A FRIEND

HIVEP1

human immunodeficiency virus type I enhancer binding protein 1

77 Gene Product Result for
Synonyms: CIRIP CRYBP1 MBP-1 PRDII-BF1 Schnurri-1 ZAS1 ZNF40 ZNF40A
UniProtKB ID: P15822, B2RTU3, Q14122, Q5MPB1, Q5VW60
Gene ID:
Human(3096) Summary: This gene encodes a transcription factor belonging to the ZAS family, members of which are large proteins that contain a ZAS domain - a modular protein structure consisting of a pair of C2H2 zinc fingers with an acidic-rich region and a serine/threonine-rich sequence. These proteins bind specifically to the DNA sequence motif, GGGACTTTCC, found in the enhancer elements of several viral promoters, including human immunodeficiency virus (HIV), and to related sequences found in the enhancer elements of a number of cellular promoters. This protein binds to this sequence motif, suggesting a role in the transcriptional regulation of both viral and cellular genes. [provided by RefSeq, Oct 2011]
Mouse(110521) human immunodeficiency virus type I enhancer binding protein 1
Rat(117140) human immunodeficiency virus type I enhancer binding protein 1
sheep(101115835) human immunodeficiency virus type I enhancer binding protein 1
Domestic Rabbit(100338658) human immunodeficiency virus type I enhancer binding protein 1
domestic guinea pig(100725918) human immunodeficiency virus type I enhancer binding protein 1
naked mole-rat(101724417) human immunodeficiency virus type I enhancer binding protein 1
Zebrafish(100000517) human immunodeficiency virus type I enhancer binding protein 1
Horse(100064320) human immunodeficiency virus type I enhancer binding protein 1
cow(529115) human immunodeficiency virus type I enhancer binding protein 1
domestic cat(101092937) human immunodeficiency virus type I enhancer binding protein 1
dog(488221) human immunodeficiency virus type I enhancer binding protein 1
chicken(420856) human immunodeficiency virus type I enhancer binding protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007772 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007772 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007772 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002114 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002114 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002114 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU032211 MISSION® esiRNA esiRNA human HIVEP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002114 Rosetta Predictions human pricing
NM_001105751 Rosetta Predictions rat pricing
NM_007772 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002114 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096804 predicted 2861
2 SASI_Hs02_00333234 predicted 6674
3 SASI_Hs02_00333235 predicted 375
4 SASI_Hs01_00096806 predicted 4856
5 SASI_Hs01_00096807 predicted 4136
6 SASI_Hs01_00096808 predicted 4286
7 SASI_Hs01_00096809 predicted 7721
8 SASI_Hs02_00333236 predicted 3403
9 SASI_Hs02_00333237 predicted 5163
10 SASI_Hs01_00096813 predicted 7491
11 SASI_Hs01_00096805 predicted 4898
12 SASI_Hs01_00096810 predicted 5326
13 SASI_Hs01_00096811 predicted 6589
14 SASI_Hs01_00096812 predicted 2001
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105751 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212176 predicted 7003
2 SASI_Rn02_00212177 predicted 5147
3 SASI_Rn02_00212178 predicted 1524
4 SASI_Rn02_00212179 predicted 5894
5 SASI_Rn02_00212180 predicted 4231
6 SASI_Rn02_00212181 predicted 7485
7 SASI_Rn02_00212182 predicted 2753
8 SASI_Rn02_00212183 predicted 7273
9 SASI_Rn02_00212184 predicted 6350
10 SASI_Rn02_00212185 predicted 1324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007772 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035168 predicted 3031
2 SASI_Mm01_00035169 predicted 4002
3 SASI_Mm01_00035170 predicted 5123
4 SASI_Mm01_00035172 predicted 2770
5 SASI_Mm01_00035173 predicted 1128
6 SASI_Mm01_00035174 predicted 1730
7 SASI_Mm01_00035175 predicted 5936
8 SASI_Mm01_00035176 predicted 5481
9 SASI_Mm01_00035177 predicted 7318
10 SASI_Mm02_00312416 predicted 4583
11 SASI_Mm01_00035171 predicted 4509
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007772
VALIDATED
HIVEP1 MISSION shRNA Bacterial Glycerol Stock
human immunodeficiency virus type I enhancer binding protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007772.1-6074s1c1
Sequence:CCGGGCAATAAAGATGACTCTGAAACTCGAGTTTCAGAGTCATCTTTATTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007772.1-5440s1c1
Sequence:CCGGGCTGCTAATTTGACTCAGGTTCTCGAGAACCTGAGTCAAATTAGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007772.1-3747s1c1
Sequence:CCGGGCGTAGTGAAACCTTATCAAACTCGAGTTTGATAAGGTTTCACTACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007772.1-583s1c1
Sequence:CCGGGCGTTCGATGTCTTACTGAAACTCGAGTTTCAGTAAGACATCGAACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007772.1-1565s1c1
Sequence:CCGGCGGTATCGAATCCCGAATCTTCTCGAGAAGATTCGGGATTCGATACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007772.2-1738s21c1
Sequence:CCGGCGGTATCGAATCCCGAATCTTCTCGAGAAGATTCGGGATTCGATACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007772.2-270s21c1
Sequence:CCGGGTCTTAGAGGCTGGCGTTAAACTCGAGTTTAACGCCAGCCTCTAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321038    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007772.2-8557s21c1
Sequence:CCGGATGATATGTTGCACTGTTAAACTCGAGTTTAACAGTGCAACATATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007772.2-5488s21c1
Sequence:CCGGGAGCTAATGAGAGCCATAAACCTCGAGGTTTATGGCTCTCATTAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007772.2-5910s21c1
Sequence:CCGGGACACTCAACAGCCGTCATTTCTCGAGAAATGACGGCTGTTGAGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007772
VALIDATED
HIVEP1 MISSION shRNA shRNA Plasmid DNA
human immunodeficiency virus type I enhancer binding protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007772.1-6074s1c1
Sequence:CCGGGCAATAAAGATGACTCTGAAACTCGAGTTTCAGAGTCATCTTTATTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007772.1-5440s1c1
Sequence:CCGGGCTGCTAATTTGACTCAGGTTCTCGAGAACCTGAGTCAAATTAGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007772.1-3747s1c1
Sequence:CCGGGCGTAGTGAAACCTTATCAAACTCGAGTTTGATAAGGTTTCACTACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007772.1-583s1c1
Sequence:CCGGGCGTTCGATGTCTTACTGAAACTCGAGTTTCAGTAAGACATCGAACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007772.1-1565s1c1
Sequence:CCGGCGGTATCGAATCCCGAATCTTCTCGAGAAGATTCGGGATTCGATACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007772.2-1738s21c1
Sequence:CCGGCGGTATCGAATCCCGAATCTTCTCGAGAAGATTCGGGATTCGATACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007772.2-270s21c1
Sequence:CCGGGTCTTAGAGGCTGGCGTTAAACTCGAGTTTAACGCCAGCCTCTAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321038    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007772.2-8557s21c1
Sequence:CCGGATGATATGTTGCACTGTTAAACTCGAGTTTAACAGTGCAACATATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007772.2-5488s21c1
Sequence:CCGGGAGCTAATGAGAGCCATAAACCTCGAGGTTTATGGCTCTCATTAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007772.2-5910s21c1
Sequence:CCGGGACACTCAACAGCCGTCATTTCTCGAGAAATGACGGCTGTTGAGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007772
VALIDATED
HIVEP1 MISSION shRNA Lentiviral Transduction Particles
human immunodeficiency virus type I enhancer binding protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007772.1-6074s1c1
Sequence:CCGGGCAATAAAGATGACTCTGAAACTCGAGTTTCAGAGTCATCTTTATTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007772.1-5440s1c1
Sequence:CCGGGCTGCTAATTTGACTCAGGTTCTCGAGAACCTGAGTCAAATTAGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007772.1-3747s1c1
Sequence:CCGGGCGTAGTGAAACCTTATCAAACTCGAGTTTGATAAGGTTTCACTACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007772.1-583s1c1
Sequence:CCGGGCGTTCGATGTCTTACTGAAACTCGAGTTTCAGTAAGACATCGAACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007772.1-1565s1c1
Sequence:CCGGCGGTATCGAATCCCGAATCTTCTCGAGAAGATTCGGGATTCGATACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007772.2-1738s21c1
Sequence:CCGGCGGTATCGAATCCCGAATCTTCTCGAGAAGATTCGGGATTCGATACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007772.2-270s21c1
Sequence:CCGGGTCTTAGAGGCTGGCGTTAAACTCGAGTTTAACGCCAGCCTCTAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321038    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007772.2-8557s21c1
Sequence:CCGGATGATATGTTGCACTGTTAAACTCGAGTTTAACAGTGCAACATATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007772.2-5488s21c1
Sequence:CCGGGAGCTAATGAGAGCCATAAACCTCGAGGTTTATGGCTCTCATTAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007772.2-5910s21c1
Sequence:CCGGGACACTCAACAGCCGTCATTTCTCGAGAAATGACGGCTGTTGAGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002114
VALIDATED
HIVEP1 MISSION shRNA Bacterial Glycerol Stock
human immunodeficiency virus type I enhancer binding protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002114.1-890s1c1
Sequence:CCGGCCTCCTATACAAACACTGCATCTCGAGATGCAGTGTTTGTATAGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002114.1-5675s1c1
Sequence:CCGGCGAGAGTTAATGAAGCTAGTACTCGAGTACTAGCTTCATTAACTCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002114.1-5568s1c1
Sequence:CCGGCCCAGCAAATAGTTTAGACATCTCGAGATGTCTAAACTATTTGCTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002114.1-4113s1c1
Sequence:CCGGGCGTAGTGAAACCTTGTCAAACTCGAGTTTGACAAGGTTTCACTACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004977    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002114.1-8755s1c1
Sequence:CCGGCCAGGTAGTTATTTGTGTTTACTCGAGTAAACACAAATAACTACCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002114.2-8674s21c1
Sequence:CCGGATGTTCCACTGTTGAATATAACTCGAGTTATATTCAACAGTGGAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002114.2-7350s21c1
Sequence:CCGGCAATCGAGGACACCTTATAATCTCGAGATTATAAGGTGTCCTCGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002114.2-2702s21c1
Sequence:CCGGCATGCCGACCACAGGTTATTCCTCGAGGAATAACCTGTGGTCGGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_002114.2-6619s21c1
Sequence:CCGGTAGGCGTCTCAGTAGGTTTAACTCGAGTTAAACCTACTGAGACGCCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002114.2-1252s21c1
Sequence:CCGGTGTCAATAAGTCCGGCTAATTCTCGAGAATTAGCCGGACTTATTGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002114
VALIDATED
HIVEP1 MISSION shRNA shRNA Plasmid DNA
human immunodeficiency virus type I enhancer binding protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002114.1-890s1c1
Sequence:CCGGCCTCCTATACAAACACTGCATCTCGAGATGCAGTGTTTGTATAGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002114.1-5675s1c1
Sequence:CCGGCGAGAGTTAATGAAGCTAGTACTCGAGTACTAGCTTCATTAACTCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002114.1-5568s1c1
Sequence:CCGGCCCAGCAAATAGTTTAGACATCTCGAGATGTCTAAACTATTTGCTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002114.1-4113s1c1
Sequence:CCGGGCGTAGTGAAACCTTGTCAAACTCGAGTTTGACAAGGTTTCACTACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004977    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002114.1-8755s1c1
Sequence:CCGGCCAGGTAGTTATTTGTGTTTACTCGAGTAAACACAAATAACTACCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002114.2-8674s21c1
Sequence:CCGGATGTTCCACTGTTGAATATAACTCGAGTTATATTCAACAGTGGAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002114.2-7350s21c1
Sequence:CCGGCAATCGAGGACACCTTATAATCTCGAGATTATAAGGTGTCCTCGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002114.2-2702s21c1
Sequence:CCGGCATGCCGACCACAGGTTATTCCTCGAGGAATAACCTGTGGTCGGCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_002114.2-6619s21c1
Sequence:CCGGTAGGCGTCTCAGTAGGTTTAACTCGAGTTAAACCTACTGAGACGCCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000237897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002114.2-1252s21c1
Sequence:CCGGTGTCAATAAGTCCGGCTAATTCTCGAGAATTAGCCGGACTTATTGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002114
VALIDATED
HIVEP1 MISSION shRNA Lentiviral Transduction Particles
human immunodeficiency virus type I enhancer binding protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002114.1-890s1c1
Sequence:CCGGCCTCCTATACAAACACTGCATCTCGAGATGCAGTGTTTGTATAGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002114.1-5675s1c1
Sequence:CCGGCGAGAGTTAATGAAGCTAGTACTCGAGTACTAGCTTCATTAACTCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002114.1-5568s1c1
Sequence:CCGGCCCAGCAAATAGTTTAGACATCTCGAGATGTCTAAACTATTTGCTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002114.1-4113s1c1
Sequence:CCGGGCGTAGTGAAACCTTGTCAAACTCGAGTTTGACAAGGTTTCACTACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004977    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002114.1-8755s1c1
Sequence:CCGGCCAGGTAGTTATTTGTGTTTACTCGAGTAAACACAAATAACTACCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002114.2-8674s21c1
Sequence:CCGGATGTTCCACTGTTGAATATAACTCGAGTTATATTCAACAGTGGAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002114.2-7350s21c1
Sequence:CCGGCAATCGAGGACACCTTATAATCTCGAGATTATAAGGTGTCCTCGATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002114.2-2702s21c1
Sequence:CCGGCATGCCGACCACAGGTTATTCCTCGAGGAATAACCTGTGGTCGGCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_002114.2-6619s21c1
Sequence:CCGGTAGGCGTCTCAGTAGGTTTAACTCGAGTTAAACCTACTGAGACGCCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002114.2-1252s21c1
Sequence:CCGGTGTCAATAAGTCCGGCTAATTCTCGAGAATTAGCCGGACTTATTGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)