EMAIL THIS PAGE TO A FRIEND

HIVEP2

human immunodeficiency virus type I enhancer binding protein 2

172 Gene Product Result for
Synonyms: HIV-EP2 MBP-2 MIBP1 SHN2 ZAS2 ZNF40B
UniProtKB ID: P31629, Q02646, Q5THT5, Q9NS05
Gene ID:
Human(3097) Summary: This gene encodes a member of a family of closely related, large, zinc finger-containing transcription factors. The encoded protein regulates transcription by binding to regulatory regions of various cellular and viral genes that maybe involved in growth, development and metastasis. The protein contains the ZAS domain comprised of two widely separated regions of zinc finger motifs, a stretch of highly acidic amino acids and a serine/threonine-rich sequence. [provided by RefSeq, Nov 2012]
Mouse(15273) human immunodeficiency virus type I enhancer binding protein 2
Rat(29721) human immunodeficiency virus type I enhancer binding protein 2
sheep(101101994) human immunodeficiency virus type I enhancer binding protein 2
domestic guinea pig(100734139) human immunodeficiency virus type I enhancer binding protein 2
naked mole-rat(101726125) human immunodeficiency virus type I enhancer binding protein 2
Zebrafish(562048) human immunodeficiency virus type I enhancer binding protein 2
cow(540396) human immunodeficiency virus type I enhancer binding protein 2
domestic cat(101089866) human immunodeficiency virus type I enhancer binding protein 2
dog(484014) human immunodeficiency virus type I enhancer binding protein 2
chicken(421672) human immunodeficiency virus type I enhancer binding protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA055954 Anti-HIVEP2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010437 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010437 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010437 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006734 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006734 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006734 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006734 Rosetta Predictions human pricing
NM_024137 Rosetta Predictions rat pricing
NM_010437 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006734 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083455 predicted 6777
2 SASI_Hs01_00083456 predicted 3195
3 SASI_Hs01_00083457 predicted 2519
4 SASI_Hs01_00083458 predicted 4614
5 SASI_Hs01_00083459 predicted 4542
6 SASI_Hs01_00083460 predicted 6787
7 SASI_Hs01_00083461 predicted 5606
8 SASI_Hs01_00083462 predicted 1666
9 SASI_Hs01_00083463 predicted 4540
10 SASI_Hs01_00083464 predicted 4767
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024137 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263860 predicted 4616
2 SASI_Rn02_00263861 predicted 3137
3 SASI_Rn01_00104487 predicted 848
4 SASI_Rn01_00104488 predicted 3826
5 SASI_Rn01_00104489 predicted 7223
6 SASI_Rn01_00104490 predicted 4576
7 SASI_Rn01_00104492 predicted 6643
8 SASI_Rn01_00104493 predicted 6206
9 SASI_Rn01_00104494 predicted 8037
10 SASI_Rn01_00104495 predicted 3004
11 SASI_Rn01_00104486 predicted 2639
12 SASI_Rn01_00104491 predicted 6211
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010437 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195857 predicted 5670
2 SASI_Mm01_00195858 predicted 2241
3 SASI_Mm01_00195859 predicted 4316
4 SASI_Mm01_00195860 predicted 3940
5 SASI_Mm01_00195861 predicted 4618
6 SASI_Mm01_00195862 predicted 6258
7 SASI_Mm01_00195863 predicted 7266
8 SASI_Mm01_00195864 predicted 2204
9 SASI_Mm01_00195865 predicted 6025
10 SASI_Mm01_00195866 predicted 7438
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010437
VALIDATED
HIVEP2 MISSION shRNA Bacterial Glycerol Stock
human immunodeficiency virus type I enhancer binding protein 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010437.2-8489s21c1
Sequence:CCGGCTTGGATCTAAACGATGTAAACTCGAGTTTACATCGTTTAGATCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010437.2-2306s21c1
Sequence:CCGGCATGTTGAAGACCACGAAATTCTCGAGAATTTCGTGGTCTTCAACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010437.2-6680s21c1
Sequence:CCGGTTCGTCATTGATCAGCTATTTCTCGAGAAATAGCTGATCAATGACGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010437.2-1230s21c1
Sequence:CCGGGTCGCCTCTGAGGACCTATTTCTCGAGAAATAGGTCCTCAGAGGCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010437.2-1426s21c1
Sequence:CCGGGTGCGAAACCCAGCGTCTTAACTCGAGTTAAGACGCTGGGTTTCGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010437.1-3199s1c1
Sequence:CCGGCGGAGTAAATCGTTTGATTATCTCGAGATAATCAAACGATTTACTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010437.1-7340s1c1
Sequence:CCGGGCAATGAACCTTCACCAGAAACTCGAGTTTCTGGTGAAGGTTCATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095774    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010437.1-7841s1c1
Sequence:CCGGGCTCTGATTCTGTAATACTAACTCGAGTTAGTATTACAGAATCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010437.1-2006s1c1
Sequence:CCGGGCCGTAAACCATACAAGAAATCTCGAGATTTCTTGTATGGTTTACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010437.1-5508s1c1
Sequence:CCGGCCGGCCTTATGTATGCAAGTTCTCGAGAACTTGCATACATAAGGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010437
VALIDATED
HIVEP2 MISSION shRNA shRNA Plasmid DNA
human immunodeficiency virus type I enhancer binding protein 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010437.2-8489s21c1
Sequence:CCGGCTTGGATCTAAACGATGTAAACTCGAGTTTACATCGTTTAGATCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010437.2-2306s21c1
Sequence:CCGGCATGTTGAAGACCACGAAATTCTCGAGAATTTCGTGGTCTTCAACATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010437.2-6680s21c1
Sequence:CCGGTTCGTCATTGATCAGCTATTTCTCGAGAAATAGCTGATCAATGACGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010437.2-1230s21c1
Sequence:CCGGGTCGCCTCTGAGGACCTATTTCTCGAGAAATAGGTCCTCAGAGGCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010437.2-1426s21c1
Sequence:CCGGGTGCGAAACCCAGCGTCTTAACTCGAGTTAAGACGCTGGGTTTCGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010437.1-3199s1c1
Sequence:CCGGCGGAGTAAATCGTTTGATTATCTCGAGATAATCAAACGATTTACTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010437.1-7340s1c1
Sequence:CCGGGCAATGAACCTTCACCAGAAACTCGAGTTTCTGGTGAAGGTTCATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095774    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010437.1-7841s1c1
Sequence:CCGGGCTCTGATTCTGTAATACTAACTCGAGTTAGTATTACAGAATCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010437.1-2006s1c1
Sequence:CCGGGCCGTAAACCATACAAGAAATCTCGAGATTTCTTGTATGGTTTACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010437.1-5508s1c1
Sequence:CCGGCCGGCCTTATGTATGCAAGTTCTCGAGAACTTGCATACATAAGGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010437
VALIDATED
HIVEP2 MISSION shRNA Lentiviral Transduction Particles
human immunodeficiency virus type I enhancer binding protein 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010437.2-8489s21c1
Sequence:CCGGCTTGGATCTAAACGATGTAAACTCGAGTTTACATCGTTTAGATCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010437.2-2306s21c1
Sequence:CCGGCATGTTGAAGACCACGAAATTCTCGAGAATTTCGTGGTCTTCAACATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010437.2-6680s21c1
Sequence:CCGGTTCGTCATTGATCAGCTATTTCTCGAGAAATAGCTGATCAATGACGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010437.2-1230s21c1
Sequence:CCGGGTCGCCTCTGAGGACCTATTTCTCGAGAAATAGGTCCTCAGAGGCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010437.2-1426s21c1
Sequence:CCGGGTGCGAAACCCAGCGTCTTAACTCGAGTTAAGACGCTGGGTTTCGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010437.1-3199s1c1
Sequence:CCGGCGGAGTAAATCGTTTGATTATCTCGAGATAATCAAACGATTTACTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010437.1-7340s1c1
Sequence:CCGGGCAATGAACCTTCACCAGAAACTCGAGTTTCTGGTGAAGGTTCATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095774    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010437.1-7841s1c1
Sequence:CCGGGCTCTGATTCTGTAATACTAACTCGAGTTAGTATTACAGAATCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010437.1-2006s1c1
Sequence:CCGGGCCGTAAACCATACAAGAAATCTCGAGATTTCTTGTATGGTTTACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010437.1-5508s1c1
Sequence:CCGGCCGGCCTTATGTATGCAAGTTCTCGAGAACTTGCATACATAAGGCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006734
VALIDATED
HIVEP2 MISSION shRNA Bacterial Glycerol Stock
human immunodeficiency virus type I enhancer binding protein 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006734.3-6639s21c1
Sequence:CCGGTCTTCGTTGATCAGCTATTTGCTCGAGCAAATAGCTGATCAACGAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006734.3-2031s21c1
Sequence:CCGGTGTCGGCTTAGTCCGAGAAATCTCGAGATTTCTCGGACTAAGCCGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006734.3-2091s21c1
Sequence:CCGGATGGGTAGGAAGGGCATAATGCTCGAGCATTATGCCCTTCCTACCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006734.3-4256s21c1
Sequence:CCGGGATCCAACCAACATCCTATATCTCGAGATATAGGATGTTGGTTGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236545    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006734.3-8434s21c1
Sequence:CCGGTTTGGACACTTGGATCTAAATCTCGAGATTTAGATCCAAGTGTCCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006734.2-5650s1c1
Sequence:CCGGCGGCCTTATGTATGCAAGTTACTCGAGTAACTTGCATACATAAGGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006734.2-2603s1c1
Sequence:CCGGGCCGACCCAATTCATTTGAAACTCGAGTTTCAAATGAATTGGGTCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_006734.2-4862s1c1
Sequence:CCGGGCAAAGAATCTTCAGATGAATCTCGAGATTCATCTGAAGATTCTTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006734.2-897s1c1
Sequence:CCGGCCATGCAATTAAGGCAGGATTCTCGAGAATCCTGCCTTAATTGCATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006734.2-3787s1c1
Sequence:CCGGGCCTTGTTTCAGTTTCAGTATCTCGAGATACTGAAACTGAAACAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006734
VALIDATED
HIVEP2 MISSION shRNA shRNA Plasmid DNA
human immunodeficiency virus type I enhancer binding protein 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006734.3-6639s21c1
Sequence:CCGGTCTTCGTTGATCAGCTATTTGCTCGAGCAAATAGCTGATCAACGAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006734.3-2031s21c1
Sequence:CCGGTGTCGGCTTAGTCCGAGAAATCTCGAGATTTCTCGGACTAAGCCGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006734.3-2091s21c1
Sequence:CCGGATGGGTAGGAAGGGCATAATGCTCGAGCATTATGCCCTTCCTACCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006734.3-4256s21c1
Sequence:CCGGGATCCAACCAACATCCTATATCTCGAGATATAGGATGTTGGTTGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236545    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006734.3-8434s21c1
Sequence:CCGGTTTGGACACTTGGATCTAAATCTCGAGATTTAGATCCAAGTGTCCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006734.2-5650s1c1
Sequence:CCGGCGGCCTTATGTATGCAAGTTACTCGAGTAACTTGCATACATAAGGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006734.2-2603s1c1
Sequence:CCGGGCCGACCCAATTCATTTGAAACTCGAGTTTCAAATGAATTGGGTCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_006734.2-4862s1c1
Sequence:CCGGGCAAAGAATCTTCAGATGAATCTCGAGATTCATCTGAAGATTCTTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006734.2-897s1c1
Sequence:CCGGCCATGCAATTAAGGCAGGATTCTCGAGAATCCTGCCTTAATTGCATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006734.2-3787s1c1
Sequence:CCGGGCCTTGTTTCAGTTTCAGTATCTCGAGATACTGAAACTGAAACAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006734
VALIDATED
HIVEP2 MISSION shRNA Lentiviral Transduction Particles
human immunodeficiency virus type I enhancer binding protein 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006734.3-6639s21c1
Sequence:CCGGTCTTCGTTGATCAGCTATTTGCTCGAGCAAATAGCTGATCAACGAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006734.3-2031s21c1
Sequence:CCGGTGTCGGCTTAGTCCGAGAAATCTCGAGATTTCTCGGACTAAGCCGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006734.3-2091s21c1
Sequence:CCGGATGGGTAGGAAGGGCATAATGCTCGAGCATTATGCCCTTCCTACCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006734.3-4256s21c1
Sequence:CCGGGATCCAACCAACATCCTATATCTCGAGATATAGGATGTTGGTTGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236545    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006734.3-8434s21c1
Sequence:CCGGTTTGGACACTTGGATCTAAATCTCGAGATTTAGATCCAAGTGTCCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006734.2-5650s1c1
Sequence:CCGGCGGCCTTATGTATGCAAGTTACTCGAGTAACTTGCATACATAAGGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006734.2-2603s1c1
Sequence:CCGGGCCGACCCAATTCATTTGAAACTCGAGTTTCAAATGAATTGGGTCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_006734.2-4862s1c1
Sequence:CCGGGCAAAGAATCTTCAGATGAATCTCGAGATTCATCTGAAGATTCTTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006734.2-897s1c1
Sequence:CCGGCCATGCAATTAAGGCAGGATTCTCGAGAATCCTGCCTTAATTGCATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006734.2-3787s1c1
Sequence:CCGGGCCTTGTTTCAGTTTCAGTATCTCGAGATACTGAAACTGAAACAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)