EMAIL THIS PAGE TO A FRIEND

HIVEP3

human immunodeficiency virus type I enhancer binding protein 3

76 Gene Product Result for
Synonyms: KBP-1 KBP1 KRC SHN3 Schnurri-3 ZAS3 ZNF40C
UniProtKB ID: Q5T1R4, A7YY91, Q5T1R5, Q9BZS0, Q9HCL7
Gene ID:
Human(59269) Summary: This gene encodes a member of the human immunodeficiency virus type 1 enhancer-binding protein family. Members of this protein family contain multiple zinc finger and acid-rich (ZAS) domains and serine-threonine rich regions. This protein acts as a transcription factor and is able to regulate nuclear factor kappaB-mediated transcription by binding the kappaB motif in target genes. This protein also binds the recombination signal sequence that flanks the V, D, and J regions of immunoglobulin and T-cell receptors. Alternate splicing results in both coding and non-coding transcript variants. [provided by RefSeq, Sep 2011]
Mouse(16656) human immunodeficiency virus type I enhancer binding protein 3
Rat(313557) human immunodeficiency virus type I enhancer binding protein 3
chicken(428208) human immunodeficiency virus type I enhancer binding protein 3
dog(100684978) human immunodeficiency virus type I enhancer binding protein 3
cow(509866) human immunodeficiency virus type I enhancer binding protein 3
domestic cat(101100901) human immunodeficiency virus type I enhancer binding protein 3
domestic guinea pig(100715083) human immunodeficiency virus type I enhancer binding protein 3
naked mole-rat(101719502) human immunodeficiency virus type I enhancer binding protein 3
sheep(101101858) human immunodeficiency virus type I enhancer binding protein 3
Domestic Rabbit(100357240) human immunodeficiency virus type I enhancer binding protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA005728 Anti-HIVEP3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010657 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010657 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010657 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024503 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024503 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024503 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127714 Rosetta Predictions human pricing
NM_024503 Rosetta Predictions human pricing
NM_001107972 Rosetta Predictions rat pricing
NM_010657 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127714 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330334 predicted 2288
2 SASI_Hs02_00330335 predicted 5632
3 SASI_Hs02_00330336 predicted 6330
4 SASI_Hs02_00330337 predicted 3051
5 SASI_Hs02_00330338 predicted 4159
6 SASI_Hs02_00330339 predicted 5988
7 SASI_Hs02_00330340 predicted 2388
8 SASI_Hs02_00330341 predicted 6413
9 SASI_Hs02_00330342 predicted 6319
10 SASI_Hs02_00330343 predicted 7272
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024503 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197426 predicted 2070
2 SASI_Hs01_00197427 predicted 5416
3 SASI_Hs01_00197428 predicted 6110
4 SASI_Hs01_00197429 predicted 2826
5 SASI_Hs01_00197430 predicted 3930
6 SASI_Hs01_00197431 predicted 5770
7 SASI_Hs01_00197433 predicted 2168
8 SASI_Hs01_00197434 predicted 6197
9 SASI_Hs01_00197435 predicted 6104
10 SASI_Hs02_00356771 predicted 7055
11 SASI_Hs01_00197432 predicted 1908
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107972 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234105 predicted 4555
2 SASI_Rn02_00234106 predicted 2884
3 SASI_Rn02_00234107 predicted 6589
4 SASI_Rn02_00234108 predicted 5298
5 SASI_Rn02_00234109 predicted 5418
6 SASI_Rn02_00234110 predicted 3172
7 SASI_Rn02_00234111 predicted 7290
8 SASI_Rn02_00234112 predicted 7385
9 SASI_Rn02_00234113 predicted 6995
10 SASI_Rn02_00234114 predicted 3489
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010657 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105121 predicted 2812
2 SASI_Mm01_00105124 predicted 6866
3 SASI_Mm01_00105122 predicted 4793
4 SASI_Mm02_00319056 predicted 7914
5 SASI_Mm01_00105125 predicted 1568
6 SASI_Mm01_00105126 predicted 5668
7 SASI_Mm01_00105127 predicted 5227
8 SASI_Mm01_00105129 predicted 6090
9 SASI_Mm01_00105130 predicted 2851
10 SASI_Mm02_00319057 predicted 2257
11 SASI_Mm01_00105123 predicted 2085
12 SASI_Mm01_00105128 predicted 3094
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010657
HIVEP3 MISSION shRNA Bacterial Glycerol Stock
human immunodeficiency virus type I enhancer binding protein 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096439    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010657.2-8577s1c1
Sequence:CCGGGCAGCAGGAAAGAGAAGAATTCTCGAGAATTCTTCTCTTTCCTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010657.2-1755s1c1
Sequence:CCGGCCTGCTCTCAAGTAGTTTGTACTCGAGTACAAACTACTTGAGAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010657.2-5401s1c1
Sequence:CCGGCCTCCAATGAGTGTAAAGAAACTCGAGTTTCTTTACACTCATTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010657.2-2610s1c1
Sequence:CCGGCGCAGCCATTGAATTACCTTTCTCGAGAAAGGTAATTCAATGGCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010657.2-3831s1c1
Sequence:CCGGCCGAAGCAAATCCTTTGACTACTCGAGTAGTCAAAGGATTTGCTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010657.3-8188s21c1
Sequence:CCGGCAAATCACACACATCCATAAACTCGAGTTTATGGATGTGTGTGATTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010657.3-5783s21c1
Sequence:CCGGGGTGAGCAAAGAGACATATACCTCGAGGTATATGTCTCTTTGCTCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010657.3-2267s21c1
Sequence:GTACCGGGACACAAGTGATCGAACATATCTCGAGATATGTTCGATCACTTGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010657.3-4523s21c1
Sequence:CCGGTTCAACCCTCTCCGGATATTTCTCGAGAAATATCCGGAGAGGGTTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010657.3-1451s21c1
Sequence:CCGGGCAGAAGCCAGGCAAGTATATCTCGAGATATACTTGCCTGGCTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010657
HIVEP3 MISSION shRNA shRNA Plasmid DNA
human immunodeficiency virus type I enhancer binding protein 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096439    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010657.2-8577s1c1
Sequence:CCGGGCAGCAGGAAAGAGAAGAATTCTCGAGAATTCTTCTCTTTCCTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010657.2-1755s1c1
Sequence:CCGGCCTGCTCTCAAGTAGTTTGTACTCGAGTACAAACTACTTGAGAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010657.2-5401s1c1
Sequence:CCGGCCTCCAATGAGTGTAAAGAAACTCGAGTTTCTTTACACTCATTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010657.2-2610s1c1
Sequence:CCGGCGCAGCCATTGAATTACCTTTCTCGAGAAAGGTAATTCAATGGCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010657.2-3831s1c1
Sequence:CCGGCCGAAGCAAATCCTTTGACTACTCGAGTAGTCAAAGGATTTGCTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010657.3-8188s21c1
Sequence:CCGGCAAATCACACACATCCATAAACTCGAGTTTATGGATGTGTGTGATTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010657.3-5783s21c1
Sequence:CCGGGGTGAGCAAAGAGACATATACCTCGAGGTATATGTCTCTTTGCTCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010657.3-2267s21c1
Sequence:GTACCGGGACACAAGTGATCGAACATATCTCGAGATATGTTCGATCACTTGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010657.3-4523s21c1
Sequence:CCGGTTCAACCCTCTCCGGATATTTCTCGAGAAATATCCGGAGAGGGTTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010657.3-1451s21c1
Sequence:CCGGGCAGAAGCCAGGCAAGTATATCTCGAGATATACTTGCCTGGCTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010657
HIVEP3 MISSION shRNA Lentiviral Transduction Particles
human immunodeficiency virus type I enhancer binding protein 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096439    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010657.2-8577s1c1
Sequence:CCGGGCAGCAGGAAAGAGAAGAATTCTCGAGAATTCTTCTCTTTCCTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010657.2-1755s1c1
Sequence:CCGGCCTGCTCTCAAGTAGTTTGTACTCGAGTACAAACTACTTGAGAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010657.2-5401s1c1
Sequence:CCGGCCTCCAATGAGTGTAAAGAAACTCGAGTTTCTTTACACTCATTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010657.2-2610s1c1
Sequence:CCGGCGCAGCCATTGAATTACCTTTCTCGAGAAAGGTAATTCAATGGCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010657.2-3831s1c1
Sequence:CCGGCCGAAGCAAATCCTTTGACTACTCGAGTAGTCAAAGGATTTGCTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010657.3-8188s21c1
Sequence:CCGGCAAATCACACACATCCATAAACTCGAGTTTATGGATGTGTGTGATTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010657.3-5783s21c1
Sequence:CCGGGGTGAGCAAAGAGACATATACCTCGAGGTATATGTCTCTTTGCTCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010657.3-2267s21c1
Sequence:GTACCGGGACACAAGTGATCGAACATATCTCGAGATATGTTCGATCACTTGTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010657.3-4523s21c1
Sequence:CCGGTTCAACCCTCTCCGGATATTTCTCGAGAAATATCCGGAGAGGGTTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010657.3-1451s21c1
Sequence:CCGGGCAGAAGCCAGGCAAGTATATCTCGAGATATACTTGCCTGGCTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024503
VALIDATED
HIVEP3 MISSION shRNA Bacterial Glycerol Stock
human immunodeficiency virus type I enhancer binding protein 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024503.3-5963s21c1
Sequence:CCGGCAAGAAGGTACGGACTCAAAGCTCGAGCTTTGAGTCCGTACCTTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024503.1-5769s1c1
Sequence:CCGGCGCTGGTTGGTGCATAAGTTTCTCGAGAAACTTATGCACCAACCAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024503.1-4722s1c1
Sequence:CCGGCCAAGAGTACAGCAGTGACATCTCGAGATGTCACTGCTGTACTCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024503.1-1072s1c1
Sequence:CCGGCCCTCATCAGTTCTTAGGGAACTCGAGTTCCCTAAGAACTGATGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024503.1-6835s1c1
Sequence:CCGGCGCAAACACTCGCTAACCAAACTCGAGTTTGGTTAGCGAGTGTTTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_024503.1-5198s1c1
Sequence:CCGGGCCTTGAACTTACCATGGAAACTCGAGTTTCCATGGTAAGTTCAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024503.3-2934s21c1
Sequence:CCGGGCCACAGCAGTCACGTGTTTACTCGAGTAAACACGTGACTGCTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024503.3-2375s21c1
Sequence:CCGGAGTACTGAGTCTGGGTATTTCCTCGAGGAAATACCCAGACTCAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024503.3-8683s21c1
Sequence:CCGGTCTGAGGCTGTGAATAGTTTACTCGAGTAAACTATTCACAGCCTCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024503.3-3775s21c1
Sequence:CCGGGGTTCCTGAGATCCTAGTAACCTCGAGGTTACTAGGATCTCAGGAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024503
VALIDATED
HIVEP3 MISSION shRNA shRNA Plasmid DNA
human immunodeficiency virus type I enhancer binding protein 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024503.3-5963s21c1
Sequence:CCGGCAAGAAGGTACGGACTCAAAGCTCGAGCTTTGAGTCCGTACCTTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024503.1-5769s1c1
Sequence:CCGGCGCTGGTTGGTGCATAAGTTTCTCGAGAAACTTATGCACCAACCAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024503.1-4722s1c1
Sequence:CCGGCCAAGAGTACAGCAGTGACATCTCGAGATGTCACTGCTGTACTCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024503.1-1072s1c1
Sequence:CCGGCCCTCATCAGTTCTTAGGGAACTCGAGTTCCCTAAGAACTGATGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024503.1-6835s1c1
Sequence:CCGGCGCAAACACTCGCTAACCAAACTCGAGTTTGGTTAGCGAGTGTTTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_024503.1-5198s1c1
Sequence:CCGGGCCTTGAACTTACCATGGAAACTCGAGTTTCCATGGTAAGTTCAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024503.3-2934s21c1
Sequence:CCGGGCCACAGCAGTCACGTGTTTACTCGAGTAAACACGTGACTGCTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024503.3-2375s21c1
Sequence:CCGGAGTACTGAGTCTGGGTATTTCCTCGAGGAAATACCCAGACTCAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024503.3-8683s21c1
Sequence:CCGGTCTGAGGCTGTGAATAGTTTACTCGAGTAAACTATTCACAGCCTCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024503.3-3775s21c1
Sequence:CCGGGGTTCCTGAGATCCTAGTAACCTCGAGGTTACTAGGATCTCAGGAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024503
VALIDATED
HIVEP3 MISSION shRNA Lentiviral Transduction Particles
human immunodeficiency virus type I enhancer binding protein 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024503.3-5963s21c1
Sequence:CCGGCAAGAAGGTACGGACTCAAAGCTCGAGCTTTGAGTCCGTACCTTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024503.1-5769s1c1
Sequence:CCGGCGCTGGTTGGTGCATAAGTTTCTCGAGAAACTTATGCACCAACCAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024503.1-4722s1c1
Sequence:CCGGCCAAGAGTACAGCAGTGACATCTCGAGATGTCACTGCTGTACTCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024503.1-1072s1c1
Sequence:CCGGCCCTCATCAGTTCTTAGGGAACTCGAGTTCCCTAAGAACTGATGAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024503.1-6835s1c1
Sequence:CCGGCGCAAACACTCGCTAACCAAACTCGAGTTTGGTTAGCGAGTGTTTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_024503.1-5198s1c1
Sequence:CCGGGCCTTGAACTTACCATGGAAACTCGAGTTTCCATGGTAAGTTCAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024503.3-2934s21c1
Sequence:CCGGGCCACAGCAGTCACGTGTTTACTCGAGTAAACACGTGACTGCTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024503.3-2375s21c1
Sequence:CCGGAGTACTGAGTCTGGGTATTTCCTCGAGGAAATACCCAGACTCAGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024503.3-8683s21c1
Sequence:CCGGTCTGAGGCTGTGAATAGTTTACTCGAGTAAACTATTCACAGCCTCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024503.3-3775s21c1
Sequence:CCGGGGTTCCTGAGATCCTAGTAACCTCGAGGTTACTAGGATCTCAGGAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)