EMAIL THIS PAGE TO A FRIEND

HJURP

Holliday junction recognition protein

58 Gene Product Result for
Synonyms: FAKTS URLC9 hFLEG1
UniProtKB ID: Q8NCD3, A8IRH5, B4DWR0, B4DZV4, Q9BUT2, Q9NSL8
Gene ID:
Mouse(381280) Holliday junction recognition protein
Rat(316602) Holliday junction recognition protein
chicken(418413) Holliday junction recognition protein
Horse(100065398) Holliday junction recognition protein
cow(617456) Holliday junction recognition protein
domestic cat(101086168) Holliday junction recognition protein
sheep(101111929) Holliday junction recognition protein
domestic guinea pig(100718607) Holliday junction recognition protein
naked mole-rat(101697608) Holliday junction recognition protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198652 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198652 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198652 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018410 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018410 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018410 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018410 Rosetta Predictions human pricing
XM_001065693 Rosetta Predictions rat pricing
XM_237403 Rosetta Predictions rat pricing
NM_198652 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018410 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179175 predicted 961
2 SASI_Hs01_00179176 predicted 903
3 SASI_Hs01_00179177 predicted 1892
4 SASI_Hs01_00179178 predicted 714
5 SASI_Hs02_00351915 predicted 1902
6 SASI_Hs01_00179180 predicted 1363
7 SASI_Hs01_00179181 predicted 1366
8 SASI_Hs01_00179182 predicted 441
9 SASI_Hs01_00179183 predicted 2022
10 SASI_Hs01_00179184 predicted 1340
11 SASI_Hs01_00179179 predicted 1705
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065693 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00315046 predicted 390
2 SASI_Rn02_00315047 predicted 1728
3 SASI_Rn02_00315048 predicted 722
4 SASI_Rn02_00315049 predicted 1776
5 SASI_Rn02_00315050 predicted 1616
6 SASI_Rn02_00315051 predicted 1173
7 SASI_Rn02_00315052 predicted 1154
8 SASI_Rn02_00315053 predicted 1050
9 SASI_Rn02_00315054 predicted 1228
10 SASI_Rn02_00315055 predicted 965
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_237403 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390907 predicted 396
2 SASI_Rn02_00390908 predicted 1721
3 SASI_Rn02_00390909 predicted 1780
4 SASI_Rn02_00390910 predicted 347
5 SASI_Rn02_00390911 predicted 1734
6 SASI_Rn02_00390912 predicted 472
7 SASI_Rn02_00390913 predicted 201
8 SASI_Rn02_00390914 predicted 375
9 SASI_Rn02_00390915 predicted 397
10 SASI_Rn02_00390916 predicted 207
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198652 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096828 predicted 1457
2 SASI_Mm01_00096829 predicted 1426
3 SASI_Mm01_00096830 predicted 1264
4 SASI_Mm01_00096831 predicted 520
5 SASI_Mm01_00096832 predicted 1234
6 SASI_Mm01_00096833 predicted 1153
7 SASI_Mm01_00096834 predicted 1686
8 SASI_Mm01_00096835 predicted 581
9 SASI_Mm01_00096836 predicted 1646
10 SASI_Mm02_00351120 predicted 1914
11 SASI_Mm01_00096837 predicted 257
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198652
VALIDATED
HJURP MISSION shRNA Bacterial Glycerol Stock
Holliday junction recognition protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198652.1-474s1c1
Sequence:CCGGGCCTCAAGATGAAGAGTATTTCTCGAGAAATACTCTTCATCTTGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192716    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198652.1-3112s1c1
Sequence:CCGGGCCAACGAAATCTTGCTACTTCTCGAGAAGTAGCAAGATTTCGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198652.1-1965s1c1
Sequence:CCGGGCCAACAAAGAGGTGCAAGTTCTCGAGAACTTGCACCTCTTTGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201454    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198652.1-3429s1c1
Sequence:CCGGCCCTGGAAGTTACTAGCCTATCTCGAGATAGGCTAGTAACTTCCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198652.1-425s1c1
Sequence:CCGGCCTTGGAAACTGATTTAAGAACTCGAGTTCTTAAATCAGTTTCCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198652
VALIDATED
HJURP MISSION shRNA shRNA Plasmid DNA
Holliday junction recognition protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198652.1-474s1c1
Sequence:CCGGGCCTCAAGATGAAGAGTATTTCTCGAGAAATACTCTTCATCTTGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192716    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198652.1-3112s1c1
Sequence:CCGGGCCAACGAAATCTTGCTACTTCTCGAGAAGTAGCAAGATTTCGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198652.1-1965s1c1
Sequence:CCGGGCCAACAAAGAGGTGCAAGTTCTCGAGAACTTGCACCTCTTTGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201454    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198652.1-3429s1c1
Sequence:CCGGCCCTGGAAGTTACTAGCCTATCTCGAGATAGGCTAGTAACTTCCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198652.1-425s1c1
Sequence:CCGGCCTTGGAAACTGATTTAAGAACTCGAGTTCTTAAATCAGTTTCCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198652
VALIDATED
HJURP MISSION shRNA Lentiviral Transduction Particles
Holliday junction recognition protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198652.1-474s1c1
Sequence:CCGGGCCTCAAGATGAAGAGTATTTCTCGAGAAATACTCTTCATCTTGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192716    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198652.1-3112s1c1
Sequence:CCGGGCCAACGAAATCTTGCTACTTCTCGAGAAGTAGCAAGATTTCGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198652.1-1965s1c1
Sequence:CCGGGCCAACAAAGAGGTGCAAGTTCTCGAGAACTTGCACCTCTTTGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201454    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198652.1-3429s1c1
Sequence:CCGGCCCTGGAAGTTACTAGCCTATCTCGAGATAGGCTAGTAACTTCCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198652.1-425s1c1
Sequence:CCGGCCTTGGAAACTGATTTAAGAACTCGAGTTCTTAAATCAGTTTCCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018410
VALIDATED
HJURP MISSION shRNA Bacterial Glycerol Stock
Holliday junction recognition protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_018410.2-825s1c1
Sequence:CCGGGAGCACAAAGCCATCAAGCATCTCGAGATGCTTGATGGCTTTGTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018410.2-2278s1c1
Sequence:CCGGCCACTTGCTCTCTGTTTGTATCTCGAGATACAAACAGAGAGCAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018410.2-1547s1c1
Sequence:CCGGCCAAGAGCGATTCATCTTCATCTCGAGATGAAGATGAATCGCTCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018410.2-1718s1c1
Sequence:CCGGGAAGGAATCGTTACGATGAAACTCGAGTTTCATCGTAACGATTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018410.2-1804s1c1
Sequence:CCGGCCTTTATGTATTGGAGTGTCTCTCGAGAGACACTCCAATACATAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018410.2-1131s1c1
Sequence:CCGGCAAAGTGACACCCTCGAAGTACTCGAGTACTTCGAGGGTGTCACTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018410.2-2181s1c1
Sequence:CCGGCACGTCTTACAGGATGGAAGACTCGAGTCTTCCATCCTGTAAGACGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018410.2-1633s1c1
Sequence:CCGGCAGGGAAATAGTTCTGGAATACTCGAGTATTCCAGAACTATTTCCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_018410.2-1834s1c1
Sequence:CCGGGCAAGTATGGAAGTTCGATATCTCGAGATATCGAACTTCCATACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_018410.2-1142s1c1
Sequence:CCGGCCTCGAAGTATTCTTCCTTGACTCGAGTCAAGGAAGAATACTTCGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018410
VALIDATED
HJURP MISSION shRNA shRNA Plasmid DNA
Holliday junction recognition protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_018410.2-825s1c1
Sequence:CCGGGAGCACAAAGCCATCAAGCATCTCGAGATGCTTGATGGCTTTGTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018410.2-2278s1c1
Sequence:CCGGCCACTTGCTCTCTGTTTGTATCTCGAGATACAAACAGAGAGCAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018410.2-1547s1c1
Sequence:CCGGCCAAGAGCGATTCATCTTCATCTCGAGATGAAGATGAATCGCTCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018410.2-1718s1c1
Sequence:CCGGGAAGGAATCGTTACGATGAAACTCGAGTTTCATCGTAACGATTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018410.2-1804s1c1
Sequence:CCGGCCTTTATGTATTGGAGTGTCTCTCGAGAGACACTCCAATACATAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018410.2-1131s1c1
Sequence:CCGGCAAAGTGACACCCTCGAAGTACTCGAGTACTTCGAGGGTGTCACTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018410.2-2181s1c1
Sequence:CCGGCACGTCTTACAGGATGGAAGACTCGAGTCTTCCATCCTGTAAGACGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018410.2-1633s1c1
Sequence:CCGGCAGGGAAATAGTTCTGGAATACTCGAGTATTCCAGAACTATTTCCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_018410.2-1834s1c1
Sequence:CCGGGCAAGTATGGAAGTTCGATATCTCGAGATATCGAACTTCCATACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_018410.2-1142s1c1
Sequence:CCGGCCTCGAAGTATTCTTCCTTGACTCGAGTCAAGGAAGAATACTTCGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018410
VALIDATED
HJURP MISSION shRNA Lentiviral Transduction Particles
Holliday junction recognition protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_018410.2-825s1c1
Sequence:CCGGGAGCACAAAGCCATCAAGCATCTCGAGATGCTTGATGGCTTTGTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018410.2-2278s1c1
Sequence:CCGGCCACTTGCTCTCTGTTTGTATCTCGAGATACAAACAGAGAGCAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018410.2-1547s1c1
Sequence:CCGGCCAAGAGCGATTCATCTTCATCTCGAGATGAAGATGAATCGCTCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018410.2-1718s1c1
Sequence:CCGGGAAGGAATCGTTACGATGAAACTCGAGTTTCATCGTAACGATTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018410.2-1804s1c1
Sequence:CCGGCCTTTATGTATTGGAGTGTCTCTCGAGAGACACTCCAATACATAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018410.2-1131s1c1
Sequence:CCGGCAAAGTGACACCCTCGAAGTACTCGAGTACTTCGAGGGTGTCACTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018410.2-2181s1c1
Sequence:CCGGCACGTCTTACAGGATGGAAGACTCGAGTCTTCCATCCTGTAAGACGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018410.2-1633s1c1
Sequence:CCGGCAGGGAAATAGTTCTGGAATACTCGAGTATTCCAGAACTATTTCCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_018410.2-1834s1c1
Sequence:CCGGGCAAGTATGGAAGTTCGATATCTCGAGATATCGAACTTCCATACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_018410.2-1142s1c1
Sequence:CCGGCCTCGAAGTATTCTTCCTTGACTCGAGTCAAGGAAGAATACTTCGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)